GDsnp00440, GDsnp00440 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00440
Aliasss475882275
rs267615220
dbSNP IDss475882275
SNP Array ID
480K SNP array for apple:AX-105198973
IRSC 9K SNP array for apple:GDsnp00440
TypeSNP
SNP AllelesR
SpeciesMalus x domestica
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00440GDsnp00440Malus x domesticamarker_locus
GDsnp00440GDsnp00440-23.021Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp00440 ID=GDsnp00440|Name=GDsnp00440|organism=Malus x domestica|type=genetic_marker|length=75bp
AGGTGCCAATAATCTCAGCAGCCAATCCAACTCCG[A/G]TGCTGTACCC
ATCGCTAAGTGAGTTGGCACCGCCG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A28.8GDsnp00440View
2Apple-FjxPL-F1-2013LG1N/A29.95GDsnp00440View
3Apple-Honeycrisp_Consensus-F11N/A23.02GDsnp00440-23.021View
Alignments
Feature NameTypeLocationAnalysis
MDC013531.194 contig MDC013531.194:13310..13310. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr07 chromosome Chr07:25311511..25311511- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:22143201..22143201- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation