RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1, RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1
Aliasss475883826
rs267616386
a475883826
SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1
AX-105220633
dbSNP IDss475883826
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1
50K SNP array for apple:RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1
TypeSNP
SNP AllelesT/C
5' Flanking SequenceATAAAATTGATTAATTAGCACACAAAAAAACTCCA
3' Flanking SequenceAGTGGAGAACATGAAATAGCTATACAAAATTACT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1-202.32Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1 ID=RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1|Name=RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
ATAAAATTGATTAATTAGCACACAAAAAAACTCCAYAGTGGAGAACATGA
AATAGCTATACAAAATTACT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-2013-physical-Malus-domestica8N/A18207227RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1View
2Pear-PH-CG-2017LG5N/A202.32RosBREEDSNP_SNP_TC_18207227_Lg8_02689_MAF40_MDP0000311217_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC020338.210 contig MDC020338.210:4728..4728. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr05 chromosome Chr05:13703579..13703579. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation