RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1, RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1
dbSNP IDss475875771
SNP Array ID
480K SNP array for apple:AX-115183746
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1
50K SNP array for apple:AX-105177796
TypeSNP
SNP AllelesM
5' Flanking SequenceAATGAGAGAAAGCATCCATTTCTAGGTACGAGAGT
3' Flanking SequenceGTAGAGTTCGTTTAACAGAAACGATGTTGAAGCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A10.69SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
2Apple_HC64_F11N/A10.05SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
3Apple_HCMO_F11N/A45.9SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
4Apple_HGMM_Consenus1N/A56.41SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
5Apple-BB-F11N/A50.18SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
6Apple-NC-F11N/A81.54SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
7Apple-NCZFBB-consensus1N/A55.49SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
8Apple-ZF-F11N/A61.72SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
9Apple-MM-F11N/A52.1b475875771View
10apple-RosBREED-sweetness-2015LG1N/A70.1ss475875771View
11Apple-Honeycrisp_Consensus-F11N/A46.55RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
12Pear-PH-CG-2017LG1N/A50.15RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1View
Sequence
>RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1 ID=RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1; Name=RosBREEDSNP_SNP_AC_31531408_Lg1_327214_MAF30_327214_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AATGAGAGAAAGCATCCATTTCTAGGTACGAGAGT[A/C]GTAGAGTTCG
TTTAACAGAAACGATGTTGAAGCAA