RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2, RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2
Aliasss475877650
rs267610596
a475877650
SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2
AX-105210264
dbSNP IDss475877650
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2
50K SNP array for apple:RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTAGAGGTTGTTAAGAACAAAGCTCGGGCAATCATG
3' Flanking SequenceAATCACCTCATCCTACCAATAAACTTCAACTTCA
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2 ID=RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2|Name=RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2|organism=Malus x domestica|type=genetic_marker|length=70bp
TAGAGGTTGTTAAGAACAAAGCTCGGGCAATCATGRAATCACCTCATCCT
ACCAATAAACTTCAACTTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20133N/A38.5RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2View
2Apple-M432-2013-physical-Malus-domestica3N/A15349068RosBREEDSNP_SNP_AG_15349068_Lg3_02546_MAF50_MDP0000454201_exon2View
Alignments
Feature NameTypeLocationAnalysis
MDC036850.12 contig MDC036850.12:11757..11757. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr03 chromosome Chr03:14533373..14533373. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr03 chromosome Chr03:14533372..14533372. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation