RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6, RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6
dbSNP IDss475878731
SNP Array ID
480K SNP array for apple:AX-105220843
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6
20K SNP array for apple:RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6
50K SNP array for apple:AX-105220843
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6.probe: CTGTCTGGCAGCTTCATACAGAGCAATGCCAACACTTACAGAGAGATTCA
5' Flanking SequenceAAGTGAAACGATTGGTGGTGGGACAATTAGGATTCCAATGGTTGAAACTTATGTAAGATG T
3' Flanking SequenceTGAATCTCTCTGTAAGTGTTGGCATTGCTCTGTATGAAGCTGCCAGACAGCTAAATTACG A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-Honeycrisp_Consensus-F17N/A0RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
2Apple-RosBREED-3.9K-20197N/A0RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
3Apple-BB-F17N/A0.59RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
4Apple-NC-F17N/A2.25RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
5Apple-NCZFBB-consensus7N/A2.25RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
6Apple-ZF-F17N/A1.15RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
7Apple-consensus-Allard-2016LG7N/A3.01RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6View
Sequence
>RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6 ID=RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6; Name=RosBREEDSNP_SNP_CT_823290_Lg7_01172_MAF40_1641721_exon6; organism=Malus x domestica; type=genetic_marker; length=75bp
TTAGGATTCCAATGGTTGAAACTTATGTAAGATGT[C/T]TGAATCTCTC
TGTAAGTGTTGGCATTGCTCTGTAT