GDsnp01815, GDsnp01815 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01815
Aliasss475882264
rs267615209
GD_01815_L1_PA
c475882264
dbSNP IDss475882264
SNP Array ID
480K SNP array for apple:AX-105203583
IRSC 9K SNP array for apple:GDsnp01815
20K SNP array for apple:GDsnp01815
TypeSNP
SNP AllelesA/G
Probe 1GDsnp01815.probe: GTAATAGAGGACAATGGGTGAAACCTAAATACGGACCAGAAGAAATCTAC
5' Flanking SequenceCCAGCCAAAGCCACTTCAGACTCGGGTTTAGTGTTCAAGAATTTCAAACTGTAATAGAGG ACAATGGGTGAAACCTAAATACGGACCAGAAGAAATCTAC
3' Flanking SequenceGCAGACAAGTACCTCACGATAAGATGAATTAACTACTTTCGTTAGCCACAAATAATTTCT TCGCAGAACAGAAGAGAATTTCTCTCAAAAGATCCAAAGA
SpeciesMalus x domestica
PolymorphismP_ GDsnp01815
Publication[view all]
ContactMichela Troggio
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit firmness at harvestq.FRFRMAH.RB-RG1.Hawke's_Bay-2010Malus x domesticaQTL
fruit firmness at harvestq.FRFRMAH.RB-RG1.Motueka-2010Malus x domesticaQTL
fruit firmness after storageq.FRFRMAS.RB-RG1.Hawke's_Bay-2009Malus x domesticaQTL
fruit firmness after storageq.FRFRMAS.RB-RG1.Motueka-2009Malus x domesticaQTL
fruit firmness after storageq.FRFRMAS.RB-RG1.Hawke's_Bay-2010Malus x domesticaQTL
fruit firmness after storageq.FRFRMAS.RB-RG1.Motueka-2010Malus x domesticaQTL
loss of firmness during storageq.LFRMDS.RB-RG1.Hawke's_Bay-2010Malus x domesticaQTL
dry matter contentq.DMC.RB-RG1.Hawke's_Bay-2009Malus x domesticaQTL
dry matter contentq.DMC.RB-RG1.Hawke's_Bay-2010Malus x domesticaQTL
fruit firmness after storageq.FRFRMAS.RB-RG1.Hawke's_Bay-2011Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01815GDsnp01815Malus x domesticamarker_locus
c475882264c475882264Malus x domesticamarker_locus
GDsnp01815GDsnp01815-8.924Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp01815.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01815 ID=GDsnp01815|Name=GDsnp01815|organism=Malus x domestica|type=genetic_marker|length=75bp
GGGTGAAACCTAAATACGGACCAGAAGAAATCTAC[A/G]GCAGACAAGT
ACCTCACGATAAGATGAATTAACTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-RGxBr-Royal Gala-F1LG1N/A8.3GDsnp01815View
2Apple_HCGA_F11N/A49.32GDsnp01815View
3Apple_HC64_F11N/A43.52GDsnp01815View
4Apple_HCMO_F11N/A9.09GDsnp01815View
5Apple_HGMM_Consenus1N/A11.08GDsnp01815View
6Apple Integrated map1N/A10.3GDsnp01815View
7Apple-RGTxGD-F1-2015GD_1N/A10.5GDsnp01815View
8Apple-Rg-F1-2014RG1N/A8.3GDsnp01815View
9Apple-FjxPL-F1-2013LG1N/A18.01GDsnp01815View
10Apple-MM-F11N/A6.4c475882264View
11Apple-Honeycrisp_Consensus-F11N/A8.92GDsnp01815-8.924View
Alignments
Feature NameTypeLocationAnalysis
MDC000410.449 contig MDC000410.449:3598..3598. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:15830725..15830725- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:15830675..15830775+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218