GDsnp01687, GDsnp01687 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01687
dbSNP IDss475882544
SNP Array ID
IRSC 9K SNP array for apple:GDsnp01687
50K SNP array for apple:AX-105200907
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATACTTGATATTCTTGTGAAGTATCCTAATATCAC
3' Flanking SequenceGTGGATGACATGGTAGAGCCTGATGAGAATGAAT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map15N/A99.4GDsnp01687View
2Pear-PM-F1-Moonglow12N/A7.56GDsnp01687View
3Apple-FjxPL-F1-2013LG15N/A81.2GDsnp01687View
4Apple-BB-F115N/A103.94GDsnp01687View
5Apple-NC-F115N/A116.7GDsnp01687View
6Apple-NCZFBB-consensus15N/A108.54GDsnp01687View
7Apple-ZF-F115N/A113.63GDsnp01687View
Sequence
>GDsnp01687 ID=GDsnp01687; Name=GDsnp01687; organism=Malus x domestica; type=genetic_marker; length=70bp
ATACTTGATATTCTTGTGAAGTATCCTAATATCACRGTGGATGACATGGT
AGAGCCTGATGAGAATGAAT