RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4, RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4
dbSNP IDss475876892
SNP Array ID
480K SNP array for apple:AX-105223055
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4
20K SNP array for apple:RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4
50K SNP array for apple:AX-105223055
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4.probe: AATTGGCAGTCTAAAGCATTAGGAGTAGTTGTTGATTCACTGAGCCTTCC
5' Flanking SequenceTCCTCTGTGACAATTGGCAGTCTAAAGCATTAGGAGTAGTTGTTGATTCACTGAGCCTTC C
3' Flanking SequenceAAGTCTACGACAATGTTAAACAGGTAATGTAATTACACAAGTACTATTTATGACACATTA A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A10.69SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
2Apple_HC64_F11N/A10.05SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
3Apple_HCMO_F11N/A44.65SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
4Apple_HGMM_Consenus1N/A56.41SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
5Apple-RosBREED-3.9K-20191N/A46.55SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
6Apple-BB-F11N/A50.59SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
7Apple-NC-F11N/A81.83SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
8Apple-NCZFBB-consensus1N/A55.98SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
9Apple-ZF-F11N/A62.5SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
10Apple-MM-F11N/A51.3c475876892View
11apple-RosBREED-sweetness-2015LG1N/A70.2ss475876892View
12Apple-Honeycrisp_Consensus-F11N/A46.55RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
13Pear-PH-CG-2017LG1N/A69.15RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4View
Sequence
>RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4 ID=RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4; Name=RosBREEDSNP_SNP_AG_31626705_Lg1_00583_MAF40_MDP0000288458_exon4; organism=Malus x domestica; type=genetic_marker; length=75bp
GCATTAGGAGTAGTTGTTGATTCACTGAGCCTTCC[A/G]AAGTCTACGA
CAATGTTAAACAGGTAATGTAATTA