|
Marker Overview
Name | RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16 |
dbSNP ID | ss475878172 |
SNP Array ID | 480K SNP array for apple: | AX-105219139 | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16 | 20K SNP array for apple: | RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16 | 50K SNP array for apple: | AX-105219139 |
|
Type | SNP |
SNP Alleles | A/C |
Probe 1 | RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16.probe: TCAATCTCTCCCTTGAACTCCCAAATATGAACGCGACTCCCATTGACCAC |
5' Flanking Sequence | AGTTTCCTTCCTCAATCTCTCCCTTGAACTCCCAAATATGAACGCGACTCCCATTGACCA
C |
3' Flanking Sequence | CCTGTGAGGCACAAACAGCCTCGCCGCACACATAAGCGTCTAGATCTAGAGTAATCCGAT
T |
Species | Malus x domestica |
Publication | [view all] |
Contact | Michela Troggio Nicola Harrison
|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2014 | Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2016 | Harrison N, Harrison RJ, Barber-Perez N, Cascant-Lopez E, Cobo-Medina M, Lipska M, Conde-Ruíz R, Brain P, Gregory PJ, Fernández-Fernández F. A new three-locus model for rootstock-induced dwarfing in apple revealed by genetic mapping of root bark percentage. Journal of experimental botany. 2016 Jan 29; 67(6):1871-1881. |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16 ID=RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16; Name=RosBREEDSNP_SNP_AC_4171437_Lg5_01566_MAF20_MDP0000307862_exon16; organism=Malus x domestica; type=genetic_marker; length=75bp AACTCCCAAATATGAACGCGACTCCCATTGACCAC[A/C]CCTGTGAGGC ACAAACAGCCTCGCCGCACACATAA
|