RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3, RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3
dbSNP IDss475879132
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3
50K SNP array for apple:AX-105204709
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATTGGTGTAAGAGAAGCTTTTGATTCAGTTAATGA
3' Flanking SequenceTGGGAGTAAGCACTCGATTAACTATGTTGAACTC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F18N/A34.56SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
2Apple_HC64_F18N/A26.31SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
3Apple_HGMM_Consenus8N/A44.37SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
4Apple-M432-20138N/A41.53SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
5Apple-M432-2013-physical-Malus-domestica8N/A22216481SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
6Apple-RosBREED-3.9K-20198N/A32.84SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
7Apple-Honeycrisp_Consensus-F18N/A32.84RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3View
Sequence
>RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3 ID=RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3; Name=RosBREEDSNP_SNP_GA_22216481_Lg8_01148_MAF20_MDP0000228182_exon3; organism=Malus x domestica; type=genetic_marker; length=70bp
ATTGGTGTAAGAGAAGCTTTTGATTCAGTTAATGARTGGGAGTAAGCACT
CGATTAACTATGTTGAACTC
Alignments
Feature NameTypeLocationAnalysis
MDC012482.269 contig MDC012482.269:11958..11958. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr08 chromosome Chr08:15397955..15397955. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation