GDsnp00324, GDsnp00324 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00324
dbSNP IDss475882745
SNP Array ID
480K SNP array for apple:AX-115181975
IRSC 9K SNP array for apple:GDsnp00324
20K SNP array for apple:GDsnp00324
50K SNP array for apple:AX-105199449
TypeSNP
SNP AllelesT/C
Probe 1GDsnp00324.probe: CGCAACGATCCCGTGCCCTCTCCTCCATCGGAAAAATCCTTCAATTATTA
5' Flanking SequenceACCAAACAGGCCCACTGCCCCGCTGGCCCGTACTGGGCCCCACTTCCCGACGCAACGATC CCGTGCCCTCTCCTCCATCGGAAAAATCCTTCAATTATTA
CATCGGAAAAATCCTT CAATTATTA
3' Flanking SequenceGACGCTCTCTGCACTCCACCTCTTTTACTCGGCTCGGCTCCCTTCTCCCGGAATGCTAAA GTCATTTCGGTTAGAGGATGCCCTTTAATTCTATATTCTT
GACGCTCTCTGCACTC CACCTCTTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Cindy F. Verdu
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map4N/A40GDsnp00324View
2Apple-C16xC17-F1-20124N/A57.75GDsnp00324View
3Apple-B-F1-2014B4N/A36.3GDsnp00324View
4Apple-JGxWSH-F1LG4N/A47.5GDsnp00324View
5Apple-RosBREED-3.9K-20194N/A39.33GDsnp00324View
6Apple-consensus-Allard-2016LG4N/A54.09GDsnp00324View
7Apple-X3259X3263-F14N/A26.16GD_SNP00324View
8Apple-Honeycrisp_Consensus-F14N/A39.33GDsnp00324View
Sequence
>GDsnp00324 ID=GDsnp00324; Name=GDsnp00324; organism=Malus x domestica; type=genetic_marker; length=201bp
ACCAAACAGGCCCACTGCCCCGCTGGCCCGTACTGGGCCCCACTTCCCGA
CGCAACGATCCCGTGCCCTCTCCTCCATCGGAAAAATCCTTCAATTATTA
YGACGCTCTCTGCACTCCACCTCTTTTACTCGGCTCGGCTCCCTTCTCCC
GGAATGCTAAAGTCATTTCGGTTAGAGGATGCCCTTTAATTCTATATTCT
T
Alignments
Feature NameTypeLocationAnalysis
MDC011804.393 contig MDC011804.393:3135..3135. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr04 chromosome Chr04:25729393..25729493+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr04 chromosome Chr04:25729443..25729443. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation