RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1, RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1
dbSNP IDss475877094
SNP Array ID
480K SNP array for apple:AX-105214364
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1
50K SNP array for apple:AX-105214364
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1.probe: GCATCGAGGACTACAAGGACAAGTACAGCGTATTGTTTCTTTTTACCCTT
5' Flanking SequenceCGTCAAGGCAAGCATCGAGGACTACAAGGACAAGTACAGCGTATTGTTTCTTTTTACCCT T
3' Flanking SequenceATCTTCATAAAACAGCTAGTTCTACTAATGGAAACCGATGCAGAAGTTCTGAGAAACCAT C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F12N/A7.42SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
2Apple_HC64_F12N/A8.38SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
3Apple_HCMO_F12N/A2.49SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
4Apple_HGMM_Consenus2N/A8.51SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
5Apple-RGTxGD-F1-2015GD_2N/A20.11SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
6Apple-RosBREED-3.9K-20192N/A12.92SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1View
7Apple-MM-F12N/A21.4b475877094View
Sequence
>RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1 ID=RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1; Name=RosBREEDSNP_SNP_CT_6266265_Lg2_00308_MAF40_1675094_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AGGACAAGTACAGCGTATTGTTTCTTTTTACCCTT[C/T]ATCTTCATAA
AACAGCTAGTTCTACTAATGGAAAC