RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9, RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9
dbSNP IDss475880373
SNP Array ID
480K SNP array for apple:AX-105200672
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9
20K SNP array for apple:RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9
50K SNP array for apple:AX-105200672
TypeSNP
SNP AllelesA/C
Probe 1RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9.probe: ACTGTTCAAGAGAATCACTGGCTAGGAAACTTGATACTAGTGGAGCAAGA
5' Flanking SequenceTTGAAGTACAAACTGTTCAAGAGAATCACTGGCTAGGAAACTTGATACTAGTGGAGCAAG A
3' Flanking SequenceGACGAAGATATAGGTACATTGTTTGTAGAAAGAAAGAATTACTTACAAATATAATCAACA A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F112N/A4.1c475880373View
2Apple-RosBREED-3.9K-201912N/A5.07RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9View
Sequence
>RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9 ID=RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9; Name=RosBREEDSNP_SNP_CA_2958778_Lg12_RosCOS1934_MAF20_1627814_exon9; organism=Malus x domestica; type=genetic_marker; length=75bp
CACTGGCTAGGAAACTTGATACTAGTGGAGCAAGA[A/C]GACGAAGATA
TAGGTACATTGTTTGTAGAAAGAAA
Alignments
Feature NameTypeLocationAnalysis
MDC007435.232 contig MDC007435.232:15612..15612. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr12 chromosome Chr12:3065992..3065992+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation