RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5, RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5
dbSNP IDss475877215
SNP Array ID
480K SNP array for apple:AX-105196289
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5
20K SNP array for apple:RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5
50K SNP array for apple:AX-105196289
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5.probe: TGTGTGAGAGAGAGAGAGATAACAAGATAATATTTGGGCAAGTCAAGACA
5' Flanking SequenceGTGTGTGTGTGTGTGTGAGAGAGAGAGAGATAACAAGATAATATTTGGGCAAGTCAAGAC A
3' Flanking SequenceTACAAAGCATTCCAAAAAGTTACAGTGACATACATTTTTAAGCCTCCAACTAAATTGATT G
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F12N/A13.12SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
2Apple_HC64_F12N/A27.15SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
3Apple_HCMO_F12N/A8.78SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
4Apple_HGMM_Consenus2N/A23.04SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
5Apple-BB-F12N/A37.86SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
6Apple-NC-F12N/A30.69SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
7Apple-NCZFBB-consensus2N/A33SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
8Apple-ZF-F12N/A25.32SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
9Apple-MM-F12N/A40.6a475877215View
10Apple-Honeycrisp_Consensus-F12N/A26.23RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5View
Sequence
>RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5 ID=RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5; Name=RosBREEDSNP_SNP_CT_14500796_Lg2_00002_MAF50_1621685_exon5; organism=Malus x domestica; type=genetic_marker; length=75bp
GAGATAACAAGATAATATTTGGGCAAGTCAAGACA[C/T]TACAAAGCAT
TCCAAAAAGTTACAGTGACATACAT
Alignments
Feature NameTypeLocationAnalysis
MDC009817.314 contig MDC009817.314:10430..10430. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:12784243..12784243+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation