RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1, RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1
Aliasss475877776
rs267610722
b475877776
SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1
AX-105200621
dbSNP IDss475877776
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1
50K SNP array for apple:RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTATGTAACCCTTCACCTTCTTCACGCAGCTTCTGG
3' Flanking SequenceTTTTTTAACTCCAAGGAGATTGCTCAGGAATATG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1 ID=RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1|Name=RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
TATGTAACCCTTCACCTTCTTCACGCAGCTTCTGGKTTTTTTAACTCCAA
GGAGATTGCTCAGGAATATG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-2013-physical-Malus-domestica3N/A33284134RosBREEDSNP_SNP_GT_33284134_Lg3_01667_MAF20_MDP0000260760_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC022078.140 contig MDC022078.140:6892..6892. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr03 chromosome Chr03:32348230..32348230. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr03 chromosome Chr03:32348229..32348229. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation