GDsnp00022, GDsnp00022 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00022
dbSNP IDss475882669
SNP Array ID
480K SNP array for apple:AX-105200480
IRSC 9K SNP array for apple:GDsnp00022
50K SNP array for apple:AX-105200480
TypeSNP
SNP AllelesR
5' Flanking SequenceGGCTCAGTTACTGCATGGGTTAGTGAAAAGTAGGT
3' Flanking SequenceGGAGGGTGTTTACGTAAAAGTTCCTTCACCAC
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map2N/A66.7GDsnp00022View
2Apple-B-F1-2014B2N/A48.7GDsnp00022View
3Apple-FjxPL-F1-2013LG2N/A56.3GDsnp00022View
4Apple-RosBREED-3.9K-20192N/A50.82GDsnp00022View
5Apple-BB-F12N/A61.44GDsnp00022View
6Apple-NC-F12N/A60.48GDsnp00022View
7Apple-NCZFBB-consensus2N/A60.67GDsnp00022View
8Apple-ZF-F12N/A62.93GDsnp00022View
9Apple-Honeycrisp_Consensus-F12N/A50.82GDsnp00022View
10Apple-GDxBr-F1-2013LG2N/A68.44GD_SNP00022View
Sequence
>GDsnp00022 ID=GDsnp00022; Name=GDsnp00022; organism=Malus x domestica; type=genetic_marker; length=72bp
GGCTCAGTTACTGCATGGGTTAGTGAAAAGTAGGT[A/G]GGAGGGTGTT
TACGTAAAAGTTCCTTCACCAC