RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18, RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18
Aliasss475876297
rs267609245
c475876297
SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18
AX-105186064
dbSNP IDss475876297
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18
50K SNP array for apple:RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18
TypeSNP
SNP AllelesT/G
5' Flanking SequenceTATAAAATATCAATGCACGAGTGCTACCCAAGTCC
3' Flanking SequenceTCTTCCATAATATGATAATTAGGAGACGCTCACG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18 ID=RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18|Name=RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18|organism=Malus x domestica|type=genetic_marker|length=70bp
TATAAAATATCAATGCACGAGTGCTACCCAAGTCCKTCTTCCATAATATG
ATAATTAGGAGACGCTCACG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201311N/A74.8RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18View
2Apple-M432-2013-physical-Malus-domestica11N/A37676795RosBREEDSNP_SNP_TG_37676795_Lg11_MDP0000258603_MAF20_MDP0000258603_exon18View
Alignments
Feature NameTypeLocationAnalysis
MDC009118.352 contig MDC009118.352:7150..7150. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:40897494..40897494. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:40897493..40897493. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation