RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7, RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7
dbSNP IDss475876937
SNP Array ID
480K SNP array for apple:AX-105193836
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7
20K SNP array for apple:RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7
50K SNP array for apple:AX-105193836
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7.probe: TGCAGGATCAAGCATCGATGTGTCTGCGCCTAGCCCTGATATTTCTGATG
5' Flanking SequenceTATCAAGACAGAGATGGTTTCGAGTCCTGTATCAGTGTCCAATGGCCAGTTTCCTTACAC T
3' Flanking SequenceCATCAGAAATATCAGGGCTAGGCGCAGACACATCGATGCTTGATCCTGCATTTACTCACT T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A4.09SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
2Apple_HC64_F11N/A2.72SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
3Apple_HCMO_F11N/A58.47SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
4Apple_HGMM_Consenus1N/A66.03SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
5apple-RGxGS-F1-2015LG1N/A49.1SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
6Apple-RGTxGD-F1-2015RGT_1N/A51.2SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
7Apple-RosBREED-3.9K-20191N/A52.51SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
8Apple-BB-F11N/A57.01SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
9Apple-NC-F11N/A86.78SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
10Apple-NCZFBB-consensus1N/A61.46SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
11Apple-ZF-F11N/A67.31SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
12Apple-consensus-Allard-2016LG1N/A59.21SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
13Apple-MM-F11N/A56.5a475876937View
14apple-RosBREED-sweetness-2015LG1N/A85.7ss475876937View
15Apple-Honeycrisp_Consensus-F11N/A52.51RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7View
Sequence
>RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7 ID=RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7; Name=RosBREEDSNP_SNP_AC_34510440_Lg1_02371_MAF50_1642607_exon7; organism=Malus x domestica; type=genetic_marker; length=75bp
CTGTATCAGTGTCCAATGGCCAGTTTCCTTACACT[A/C]CATCAGAAAT
ATCAGGGCTAGGCGCAGACACATCG