RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1, RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1
dbSNP IDss475883413
SNP Array ID
480K SNP array for apple:AX-105194594
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1
20K SNP array for apple:RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1
50K SNP array for apple:AX-105194594
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1.probe: AACGAAAACAAAATATTGTAACAAAAGAATTACAGAGACACTACAAGCCC
5' Flanking SequenceGACCTCTAGACAACGAAAACAAAATATTGTAACAAAAGAATTACAGAGACACTACAAGCC C
3' Flanking SequenceAACTAAAATGATACAAAAGGCTAATATAACATAAAGTACAGTTACCATGAATTTCGATAG C
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
MDC005454.165contigMDC005454.165:3009..3009 .Malus x domestica Whole Genome v1.0 Assembly & Annotationn/a
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A56.79SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
2Apple_HC64_F11N/A50.99SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
3Apple_HCMO_F11N/A0SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
4Apple_HGMM_Consenus1N/A2.05SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
5Apple-Honeycrisp_Consensus-F11N/A0SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
6Apple-RosBREED-3.9K-20191N/A0SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1View
7Apple-MM-F11N/A0.6c475883413View
8apple-RosBREED-sweetness-2015LG1N/A1.5ss475883413View
Sequence
>RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1 ID=RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1; Name=RosBREEDSNP_SNP_TC_3094248_Lg1_02894_MAF50_285661_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
TTGTAACAAAAGAATTACAGAGACACTACAAGCCC[C/T]AACTAAAATG
ATACAAAAGGCTAATATAACATAAA