GDsnp01500, GDsnp01500 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01500
Aliasss475882271
rs267615216
GD_01500_L1_49_1
b475882271
dbSNP IDss475882271
SNP Array ID
480K SNP array for apple:AX-105193413
IRSC 9K SNP array for apple:GDsnp01500
20K SNP array for apple:GDsnp01500
TypeSNP
SNP AllelesT/C
Probe 1GDsnp01500.probe: ATAATGGGTTGAAATGGGCTGCACGTGCAATGAGATTTGTATCTACATCA
5' Flanking SequenceGAAATGTTGTACTTGTCAAAGTCATGAATCATGCCTGAACTGCCCAATTGATAATGGGTT GAAATGGGCTGCACGTGCAATGAGATTTGTATCTACATCA
3' Flanking SequenceATGGGCTAATGGGAGGCTTGAACTGACCATTTGATTCGACTGGTTAAACTGTTTTTACTC AAGTTTTTCTCTTTATGTTAAAAGAACTTTGTATCTACTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Cindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01500GDsnp01500Malus x domesticamarker_locus
b475882271b475882271Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp01500.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01500 ID=GDsnp01500|Name=GDsnp01500|organism=Malus x domestica|type=genetic_marker|length=201bp
GAAATGTTGTACTTGTCAAAGTCATGAATCATGCCTGAACTGCCCAATTG
ATAATGGGTTGAAATGGGCTGCACGTGCAATGAGATTTGTATCTACATCA
YATGGGCTAATGGGAGGCTTGAACTGACCATTTGATTCGACTGGTTAAAC
TGTTTTTACTCAAGTTTTTCTCTTTATGTTAAAAGAACTTTGTATCTACT
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map1N/A20.3GDsnp01500View
2Apple-RGTxGD-F1-2015GD_1N/A19.33GDsnp01500View
3Apple-FjxPL-F1-2013LG1N/A37.42GDsnp01500View
4Apple-MM-F11N/A18.3b475882271View
Alignments
Feature NameTypeLocationAnalysis
MDC018447.317 contig MDC018447.317:8816..8816. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com