RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5, RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5
dbSNP IDss475876939
SNP Array ID
480K SNP array for apple:AX-105207802
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5
20K SNP array for apple:RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5
50K SNP array for apple:AX-105207802
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5.probe: TCCGGAAATCAGATAACGATTTTGCAGAAGGAGGACGAATACTCAAAGCC
5' Flanking SequenceTGGCTGTTGCTTCCGGAAATCAGATAACGATTTTGCAGAAGGAGGACGAATACTCAAAGC C
3' Flanking SequenceTGCGGCACTTTTACAAGTAAGTTAAGTTGTATTTCATTGGTTTTGTTGTCCTTGCATTTG T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A2.46SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
2Apple_HC64_F11N/A0.9SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
3Apple_HCMO_F11N/A61SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
4Apple_HGMM_Consenus1N/A67.95SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
5Apple-RosBREED-3.9K-20191N/A55.57SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
6Apple-BB-F11N/A60.17SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
7Apple-NC-F11N/A91.75SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
8Apple-NCZFBB-consensus1N/A64.8SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
9Apple-ZF-F11N/A69.97SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
10Apple-consensus-Allard-2016LG1N/A62.15SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
11apple-RosBREED-sweetness-2015LG1N/A87.4ss475876939View
12Apple-Honeycrisp_Consensus-F11N/A55.57RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5View
Sequence
>RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5 ID=RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5; Name=RosBREEDSNP_SNP_AG_35192538_Lg1_00495_MAF30_MDP0000302199_exon5; organism=Malus x domestica; type=genetic_marker; length=75bp
ACGATTTTGCAGAAGGAGGACGAATACTCAAAGCC[A/G]TGCGGCACTT
TTACAAGTAAGTTAAGTTGTATTTC