RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8, RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
Aliasss475880262
rs267613207
b475880262
SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
R_30592203_L11_PA
dbSNP IDss475880262
SNP Array ID
480K SNP array for apple:RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
20K SNP array for apple:RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
50K SNP array for apple:RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8.probe: TATGCAGAGAAAACCCTCATGAATTCATCGCTGAGGATCTTAAAGTCGGT
5' Flanking SequenceGTCTCTTTTTGTATGCAGAGAAAACCCTCATGAATTCATCGCTGAGGATCTTAAAGTCGG T
3' Flanking SequenceATGGATTTGGAAAAGAATTATACGTACCATTTCATGGCATTTCCCTTCAACGTGGTAGGG A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8Malus x domesticamarker_locus
RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8-148.47Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8 ID=RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8|Name=RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8|organism=Malus x domestica|type=genetic_marker|length=75bp
CTCATGAATTCATCGCTGAGGATCTTAAAGTCGGT[A/G]ATGGATTTGG
AAAAGAATTATACGTACCATTTCAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-201311N/A58.9RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8View
2Apple-M432-2013-physical-Malus-domestica11N/A30592203RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8View
3Pear-PH-CG-2017LG11N/A148.47RosBREEDSNP_SNP_GA_30592203_Lg11_02838_MAF20_MDP0000171255_exon8View
Alignments
Feature NameTypeLocationAnalysis
MDC004318.290 contig MDC004318.290:20638..20638. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:34394812..34394812+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:34394813..34394813. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation