GDsnp01783, GDsnp01783 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01783
Aliasss475882276
rs267615221
GD_01783_L1_PA
dbSNP IDss475882276
SNP Array ID
480K SNP array for apple:AX-105194116
IRSC 9K SNP array for apple:GDsnp01783
20K SNP array for apple:GDsnp01783
TypeSNP
SNP AllelesA/C
Probe 1GDsnp01783.probe: TTTGAGCAACAACACACATTAATCATTGTGCAAAGTAACATTGTCCACAG
5' Flanking SequenceTACTGTTTCAAGGATATGGATGCCTCTTTAAGAATTTCTACTCTACGTATTTTGAGCAAC AACACACATTAATCATTGTGCAAAGTAACATTGTCCACAG
3' Flanking SequenceAAAATGCACAGCTTAAGGATCNNCGAGAATTCACAGAGAGCGGGAACAGANAAAAAAAAA GGAGAAAAGCCTTCCCTTCAAATAACACGGAACCTCTGAA
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
glucose contentqGLC.RBP.LG1.WSU12-20.1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp01783GDsnp01783Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeGDsnp01783.probeMalus x domesticaprobe


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp01783 ID=GDsnp01783|Name=GDsnp01783|organism=Malus x domestica|type=genetic_marker|length=61bp
ACATTAATCATTGTGCAAAGTAACATTGTCCACAG[A/C]AAAATGCACA
GCTTAAGGATC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A36.05GDsnp01783View
2Apple_HGMM_Consenus1N/A26.46GDsnp01783View
3Apple Integrated map1N/A31.5GDsnp01783View
4Apple-RGTxGD-F1-2015GD_1N/A29.1GDsnp01783View
5Apple-FjxPL-F1-2013LG1N/A29.75GDsnp01783View
Alignments
Feature NameTypeLocationAnalysis
MDC015887.78 contig MDC015887.78:17059..17059. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:22310290..22310290- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:22310240..22310340+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218