RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7, RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7
dbSNP IDss475883427
SNP Array ID
480K SNP array for apple:AX-115182946
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7
20K SNP array for apple:RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7
50K SNP array for apple:AX-105174849
TypeSNP
SNP AllelesA/C
Probe 1RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7.probe: AAGTGATGTATGTACAATTGTAGGATTATGACATATTAGAAGCAAAGGTG
5' Flanking SequenceATATACCCTACCTTTTTGCCCAAGGTGAGATGAAATTCGGGATAGTTTTTAAGTACGTAC T
3' Flanking SequenceCACCTTTGCTTCTAATATGTCATAATCCTACAATTGTACATACATCACTTATCAAATCAA T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A4.09SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
2Apple_HC64_F11N/A2.72SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
3Apple_HCMO_F11N/A58.47SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
4Apple_HGMM_Consenus1N/A66.03SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
5Apple-RosBREED-3.9K-20191N/A52.33SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
6Apple-consensus-Allard-2016LG1N/A59.16SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
7Apple-Honeycrisp_Consensus-F11N/A52.33RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7View
Sequence
>RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7 ID=RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7; Name=RosBREEDSNP_SNP_TG_34487221_Lg1_02371_MAF10_MDP0000194123_exon7; organism=Malus x domestica; type=genetic_marker; length=75bp
GAGATGAAATTCGGGATAGTTTTTAAGTACGTACT[G/T]CACCTTTGCT
TCTAATATGTCATAATCCTACAATT