RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3, RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3
dbSNP IDss475883507
SNP Array ID
480K SNP array for apple:AX-115182397
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3
20K SNP array for apple:RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3
50K SNP array for apple:AX-105178717
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3.probe: TTTATCATTAACTGGTGTAACCAAGATATGGGTCTCTAGTTGTATTTTCT
5' Flanking SequenceAAGGATGGTGATTCCTATATATTCATGAACATTAAATACTTGATGGGCACTGACAAAGTG C
3' Flanking SequenceAGAAAATACAACTAGAGACCCATATCTTGGTTACACCAGTTAATGATAAAGAAATGAAAA T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Nicola Harrison
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Nicola Harrison
First name:Nicola
Last name:Harrison
Address:East Malling Research, New Road, East Malling, Kent ME19 6BJ, UK
Email:nicola.harrison@emr.ac.uk
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Harrison N, Harrison RJ, Barber-Perez N, Cascant-Lopez E, Cobo-Medina M, Lipska M, Conde-Ruíz R, Brain P, Gregory PJ, Fernández-Fernández F. A new three-locus model for rootstock-induced dwarfing in apple revealed by genetic mapping of root bark percentage. Journal of experimental botany. 2016 Jan 29; 67(6):1871-1881.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F15N/A57.4a475883507View
2Apple-RGTxGD-F1-2015RGT_5N/A47.71RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3View
3Apple-RosBREED-3.9K-20195N/A20.74RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3View
4Apple-M27xM116-2016LG5N/A55.7RBbinsnp0054View
5Apple-Honeycrisp_Consensus-F15N/A60.17RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3View
Sequence
>RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3 ID=RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3; Name=RosBREEDSNP_SNP_CA_30366787_Lg5_01751_MAF20_1650615_exon3; organism=Malus x domestica; type=genetic_marker; length=75bp
GAACATTAAATACTTGATGGGCACTGACAAAGTGC[A/C]AGAAAATACA
ACTAGAGACCCATATCTTGGTTACA
Alignments
Feature NameTypeLocationAnalysis
MDC001151.371 contig MDC001151.371:14449..14449. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr05 chromosome Chr05:19981307..19981307+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr05 chromosome Chr05:19981309..19981309. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation