|
Marker Overview
Name | RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1 |
dbSNP ID | ss475876865 |
SNP Array ID | 480K SNP array for apple: | AX-105176375 | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1 | 20K SNP array for apple: | RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1 | 50K SNP array for apple: | AX-105176375 |
|
Type | SNP |
SNP Alleles | A/G |
Probe 1 | RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1.probe: ACCACGGTCAGCACGACGAGTCCGATTAATGTTTCGGCGTCGGAGAAAGT |
5' Flanking Sequence | TGAAGACGACGACCACGGTCAGCACGACGAGTCCGATTAATGTTTCGGCGTCGGAGAAAG
T |
3' Flanking Sequence | CGGCCGAGGATGACCAGGGGCTGATCGGACGCTCGAAACAGGTAGAGGAAAGCCCACGCG
C |
Species | Malus x domestica |
Publication | [view all] |
Contact | Michela Troggio
|
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2014 | Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
2012 | Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745. |
2020 | Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8 |
Sequence
>RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1 ID=RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1; Name=RosBREEDSNP_SNP_AG_26743462_Lg1_01228_MAF20_477610_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp ACGAGTCCGATTAATGTTTCGGCGTCGGAGAAAGT[A/G]CGGCCGAGGA TGACCAGGGGCTGATCGGACGCTCG
|