RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2, RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
Aliasss475877545
rs267610492
b475877545
SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
R_5177248_L3_PA
dbSNP IDss475877545
SNP Array ID
480K SNP array for apple:RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
20K SNP array for apple:RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
50K SNP array for apple:RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2
TypeSNP
SNP AllelesT/G
Probe 1RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2.probe: TTCTCGGGTACTTGTTATTTTGTTTGTTCCCACCAATAAACGAGGTGCCA
5' Flanking SequenceAATTAGTGCTCTTCTCGGGTACTTGTTATTTTGTTTGTTCCCACCAATAAACGAGGTGCC A
3' Flanking SequenceACATCTCCCAACCAGCGAGGTGGATAGGAGAACTGCTAAGGGGAAGTCCATGGTTGCTAC A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2 ID=RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2|Name=RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2|organism=Malus x domestica|type=genetic_marker|length=75bp
TATTTTGTTTGTTCCCACCAATAAACGAGGTGCCA[G/T]ACATCTCCCA
ACCAGCGAGGTGGATAGGAGAACTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20132N/A0RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2View
2Apple-M432-2013-physical-Malus-domestica3N/A5177248RosBREEDSNP_SNP_GT_5177248_Lg3_01957_MAF50_MDP0000134469_exon2View
Alignments
Feature NameTypeLocationAnalysis
MDC000478.425 contig MDC000478.425:6095..6095. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr03 chromosome Chr03:3747271..3747271+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr03 chromosome Chr03:3747272..3747272. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation