RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3, RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3
dbSNP IDss475879344
SNP Array ID
480K SNP array for apple:AX-115182540
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3
20K SNP array for apple:RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3.probe: CCTCCAGAGAAAAACTTGTAACTGCTATAGATGAGTAGACCCCAGCCAGA
5' Flanking SequenceCTTCCTTCTTGCCTCCAGAGAAAAACTTGTAACTGCTATAGATGAGTAGACCCCAGCCAG A
3' Flanking SequenceAGAGATACAATTACGAACTGAAAAAGTACATAATCCAGTCAAGACAAGTTCAAAACTTTA T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F19N/A23.1c475879344View
2Apple-Honeycrisp_Consensus-F19N/A12.41RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3View
3Apple-RosBREED-3.9K-20199N/A12.41RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3View
4Apple-consensus-Allard-2016LG9N/A19.23RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3View
Sequence
>RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3 ID=RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3; Name=RosBREEDSNP_SNP_CT_5981805_Lg9_01603_MAF50_1683899_exon3; organism=Malus x domestica; type=genetic_marker; length=75bp
TTGTAACTGCTATAGATGAGTAGACCCCAGCCAGA[C/T]AGAGATACAA
TTACGAACTGAAAAAGTACATAATC