RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1, RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1
dbSNP IDss475883912
SNP Array ID
480K SNP array for apple:AX-105184133
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1
20K SNP array for apple:RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1
50K SNP array for apple:AX-105184133
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1.probe: CCAGAGGACTCACCCAACACACGGGGCCAAGGGACCTACCATCATTGTGC
5' Flanking SequenceCCACGTGGAGCCCAGAGGACTCACCCAACACACGGGGCCAAGGGACCTACCATCATTGTG C
3' Flanking SequenceGTGCCAATGGGATCTACCCATCACGTGGCAGTATAGGTGCGCTCCCTGGCTCTGATACCA T
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Nicola Harrison
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Nicola Harrison
First name:Nicola
Last name:Harrison
Address:East Malling Research, New Road, East Malling, Kent ME19 6BJ, UK
Email:nicola.harrison@emr.ac.uk
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Harrison N, Harrison RJ, Barber-Perez N, Cascant-Lopez E, Cobo-Medina M, Lipska M, Conde-Ruíz R, Brain P, Gregory PJ, Fernández-Fernández F. A new three-locus model for rootstock-induced dwarfing in apple revealed by genetic mapping of root bark percentage. Journal of experimental botany. 2016 Jan 29; 67(6):1871-1881.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-MM-F111N/A35b475883912View
2Apple-M27xM116-2016LG11N/A37.8RBsnp1513View
3Apple-Honeycrisp_Consensus-F111N/A24.87RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
4Apple-RosBREED-3.9K-201911N/A24.87RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
5Apple-BB-F111N/A28.59RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
6Apple-NC-F111N/A35.77RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
7Apple-NCZFBB-consensus11N/A27.09RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
8Apple-ZF-F111N/A28.13RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1View
Sequence
>RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1 ID=RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1; Name=RosBREEDSNP_SNP_GA_12169230_Lg11_00240_MAF30_MDP0000433647_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
AACACACGGGGCCAAGGGACCTACCATCATTGTGC[A/G]GTGCCAATGG
GATCTACCCATCACGTGGCAGTATA