RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5, RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5
Aliasss475877786
rs267610732
R_33672910_L3_PA
dbSNP IDss475877786
SNP Array ID
480K SNP array for apple:AX-105178211
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5
20K SNP array for apple:RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5.probe: TTGATCTATAATGTTGCAGGAGGCGGTGAGAGCCATTTGTATGGAACTGA
5' Flanking SequenceATGCAAGTACAAAACAAAAGTTAAAATTGTTAAATCCGTTCCTTAAATAATATAGCGGCC C
3' Flanking SequenceTCAGTTCCATACAAATGGCTCTCACCGCCTCCTGCAACATTATAGATCAACAGATTTAAC A
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5
Publication[view all]
ContactMichela Troggio
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5Malus x domesticamarker_locus
RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5-60.597Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5 ID=RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5|Name=RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5|organism=Malus x domestica|type=genetic_marker|length=75bp
TTGTTAAATCCGTTCCTTAAATAATATAGCGGCCC[C/T]TCAGTTCCAT
ACAAATGGCTCTCACCGCCTCCTGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20133N/A54.5RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5View
2Apple-M432-2013-physical-Malus-domestica3N/A33672910RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5View
3Apple-Honeycrisp_Consensus-F13N/A60.6RosBREEDSNP_SNP_CT_33672910_Lg3_01014_MAF30_1641420_exon5-60.597View
Alignments
Feature NameTypeLocationAnalysis
MDC009129.481 contig MDC009129.481:16061..16061. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:37644332..37644332- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr03 chromosome Chr03:32681421..32681421- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218