GDsnp01663, GDsnp01663 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp01663
dbSNP IDss475882639
SNP Array ID
480K SNP array for apple:AX-115181856
IRSC 9K SNP array for apple:GDsnp01663
50K SNP array for apple:AX-105186404
TypeSNP
SNP AllelesR
5' Flanking SequenceACAGGATATAAATATTTTTGCTCACTACCGATTAT
3' Flanking SequenceATGTATGTTCACTATAATTATAGTGAAATCCAAT
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F12N/A0GDsnp01663View
2Apple_HGMM_Consenus2N/A0GDsnp01663View
3Apple Integrated map2N/A16.4GDsnp01663View
4Apple-FjxPL-F1-2013LG2N/A25.32GDsnp01663View
5Apple-MM-F12N/A20.7b475882639View
Sequence
>GDsnp01663 ID=GDsnp01663; Name=GDsnp01663; organism=Malus x domestica; type=genetic_marker; length=63bp
TATTTTTGCTCACTACCAATTAT[A/G]ATGTATGTTCACTATAATTATA
GTGAAATCCAATG
Alignments
Feature NameTypeLocationAnalysis
MDC000132.373 contig MDC000132.373:4298..4298. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr02 chromosome Chr02:6069239..6069239+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr02 chromosome Chr02:6069241..6069241. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation