RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1, RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1
Aliasss475876867
rs267609814
a475876867
SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1
AX-105180112
dbSNP IDss475876867
SNP Array ID
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1
50K SNP array for apple:RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1
TypeSNP
SNP AllelesA/C
5' Flanking SequenceCTCAGTGCGTGAGAATAGTTTCCGAATCTCATCTA
3' Flanking SequenceTCTGTTGGTAGGAGGTACTTGGAAAGAAAATAGA
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1
Publication[view all]
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1-38.791Malus x domesticamarker_locus
RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1-41.56Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-01-32Mdo-HB-01-32Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-01-32_2Malus x domesticahaplotype
3Mdo-HB-01-32_3Malus x domesticahaplotype
4Mdo-HB-01-32_4Malus x domesticahaplotype
5Mdo-HB-01-32_5Malus x domesticahaplotype
6Mdo-HB-01-32_6Malus x domesticahaplotype
7Mdo-HB-01-32_7Malus x domesticahaplotype
8Mdo-HB-01-32_8Malus x domesticahaplotype
9Mdo-HB-01-32_9Malus x domesticahaplotype
10Mdo-HB-01-32_10Malus x domesticahaplotype
11Mdo-HB-01-32_11Malus x domesticahaplotype
12Mdo-HB-01-32_12Malus x domesticahaplotype
13Mdo-HB-01-32_13Malus x domesticahaplotype
14Mdo-HB-01-32_14Malus x domesticahaplotype
15Mdo-HB-01-32_15Malus x domesticahaplotype
16Mdo-HB-01-32_16Malus x domesticahaplotype
17Mdo-HB-01-32_17Malus x domesticahaplotype
18Mdo-HB-01-32_18Malus x domesticahaplotype
19Mdo-HB-01-32_19Malus x domesticahaplotype
20Mdo-HB-01-32_20Malus x domesticahaplotype
21Mdo-HB-01-32_21Malus x domesticahaplotype
22Mdo-HB-01-32_22Malus x domesticahaplotype
23Mdo-HB-01-32_23Malus x domesticahaplotype
24Mdo-HB-01-32_24Malus x domesticahaplotype
25Mdo-HB-01-32_25Malus x domesticahaplotype
26Mdo-HB-01-32_26Malus x domesticahaplotype
27Mdo-HB-01-32_27Malus x domesticahaplotype
28Mdo-HB-01-32_28Malus x domesticahaplotype
29Mdo-HB-01-32_29Malus x domesticahaplotype
30Mdo-HB-01-32_30Malus x domesticahaplotype
31Mdo-HB-01-32_31Malus x domesticahaplotype
32Mdo-HB-01-32_32Malus x domesticahaplotype
33Mdo-HB-01-32_33Malus x domesticahaplotype
34Mdo-HB-01-32_34Malus x domesticahaplotype
35Mdo-HB-01-32_35Malus x domesticahaplotype
36Mdo-HB-01-32_36Malus x domesticahaplotype
37Mdo-HB-01-32_37Malus x domesticahaplotype
38Mdo-HB-01-32_38Malus x domesticahaplotype
39Mdo-HB-01-32_39Malus x domesticahaplotype
40Mdo-HB-01-32_40Malus x domesticahaplotype
41Mdo-HB-01-32_41Malus x domesticahaplotype
42Mdo-HB-01-32_42Malus x domesticahaplotype
43Mdo-HB-01-32_43Malus x domesticahaplotype
44Mdo-HB-01-32_44Malus x domesticahaplotype
45Mdo-HB-01-32_45Malus x domesticahaplotype
46Mdo-HB-01-32_46Malus x domesticahaplotype
47Mdo-HB-01-32_47Malus x domesticahaplotype
48Mdo-HB-01-32_48Malus x domesticahaplotype
49Mdo-HB-01-32_49Malus x domesticahaplotype
50Mdo-HB-01-32_50Malus x domesticahaplotype
51Mdo-HB-01-32_51Malus x domesticahaplotype
52Mdo-HB-01-32_52Malus x domesticahaplotype
53Mdo-HB-01-32_53Malus x domesticahaplotype
54Mdo-HB-01-32_54Malus x domesticahaplotype
55Mdo-HB-01-32_55Malus x domesticahaplotype
56Mdo-HB-01-32_56Malus x domesticahaplotype
57Mdo-HB-01-32_57Malus x domesticahaplotype
58Mdo-HB-01-32_58Malus x domesticahaplotype
59Mdo-HB-01-32_59Malus x domesticahaplotype
60Mdo-HB-01-32_60Malus x domesticahaplotype
61Mdo-HB-01-32_61Malus x domesticahaplotype
62Mdo-HB-01-32_62Malus x domesticahaplotype
63Mdo-HB-01-32_63Malus x domesticahaplotype
64Mdo-HB-01-32_64Malus x domesticahaplotype
65Mdo-HB-01-32_65Malus x domesticahaplotype
66Mdo-HB-01-32_66Malus x domesticahaplotype
67Mdo-HB-01-32_67Malus x domesticahaplotype
68Mdo-HB-01-32_68Malus x domesticahaplotype
69Mdo-HB-01-32_69Malus x domesticahaplotype
70Mdo-HB-01-32_70Malus x domesticahaplotype
71Mdo-HB-01-32_71Malus x domesticahaplotype
72Mdo-HB-01-32_72Malus x domesticahaplotype
73Mdo-HB-01-32_73Malus x domesticahaplotype
74Mdo-HB-01-32_74Malus x domesticahaplotype
75Mdo-HB-01-32_75Malus x domesticahaplotype
76Mdo-HB-01-32_76Malus x domesticahaplotype
77Mdo-HB-01-32_77Malus x domesticahaplotype
78Mdo-HB-01-32_78Malus x domesticahaplotype
79Mdo-HB-01-32_79Malus x domesticahaplotype
80Mdo-HB-01-32_80Malus x domesticahaplotype
81Mdo-HB-01-32_81Malus x domesticahaplotype
82Mdo-HB-01-32_82Malus x domesticahaplotype
83Mdo-HB-01-32_83Malus x domesticahaplotype
84Mdo-HB-01-32_84Malus x domesticahaplotype
85Mdo-HB-01-32_85Malus x domesticahaplotype
86Mdo-HB-01-32_86Malus x domesticahaplotype
87Mdo-HB-01-32_87Malus x domesticahaplotype
88Mdo-HB-01-32_88Malus x domesticahaplotype
89Mdo-HB-01-32_89Malus x domesticahaplotype
90Mdo-HB-01-32_90Malus x domesticahaplotype
91Mdo-HB-01-32_91Malus x domesticahaplotype
92Mdo-HB-01-32_92Malus x domesticahaplotype
93Mdo-HB-01-32_93Malus x domesticahaplotype
94Mdo-HB-01-32_94Malus x domesticahaplotype
95Mdo-HB-01-32_95Malus x domesticahaplotype
96Mdo-HB-01-32_96Malus x domesticahaplotype
97Mdo-HB-01-32_97Malus x domesticahaplotype
98Mdo-HB-01-32_98Malus x domesticahaplotype
99Mdo-HB-01-32_99Malus x domesticahaplotype
100Mdo-HB-01-32_100Malus x domesticahaplotype
101Mdo-HB-01-32_101Malus x domesticahaplotype
102Mdo-HB-01-32_102Malus x domesticahaplotype
103Mdo-HB-01-32_103Malus x domesticahaplotype
104Mdo-HB-01-32_104Malus x domesticahaplotype
105Mdo-HB-01-32_105Malus x domesticahaplotype
106Mdo-HB-01-32_106Malus x domesticahaplotype
107Mdo-HB-01-32_107Malus x domesticahaplotype
108Mdo-HB-01-32_108Malus x domesticahaplotype
109Mdo-HB-01-32_109Malus x domesticahaplotype
110Mdo-HB-01-32_110Malus x domesticahaplotype
111Mdo-HB-01-32_111Malus x domesticahaplotype
112Mdo-HB-01-32_112Malus x domesticahaplotype
113Mdo-HB-01-32_113Malus x domesticahaplotype
114Mdo-HB-01-32_114Malus x domesticahaplotype
115Mdo-HB-01-32_115Malus x domesticahaplotype
116Mdo-HB-01-32_116Malus x domesticahaplotype
117Mdo-HB-01-32_117Malus x domesticahaplotype
118Mdo-HB-01-32_118Malus x domesticahaplotype
119Mdo-HB-01-32_119Malus x domesticahaplotype
120Mdo-HB-01-32_120Malus x domesticahaplotype
121Mdo-HB-01-32_121Malus x domesticahaplotype
122Mdo-HB-01-32_122Malus x domesticahaplotype
123Mdo-HB-01-32_123Malus x domesticahaplotype
124Mdo-HB-01-32_124Malus x domesticahaplotype
125Mdo-HB-01-32_125Malus x domesticahaplotype
126Mdo-HB-01-32_126Malus x domesticahaplotype
127Mdo-HB-01-32_127Malus x domesticahaplotype
128Mdo-HB-01-32_128Malus x domesticahaplotype
129Mdo-HB-01-32_129Malus x domesticahaplotype
130Mdo-HB-01-32_130Malus x domesticahaplotype
131Mdo-HB-01-32_131Malus x domesticahaplotype
132Mdo-HB-01-32_132Malus x domesticahaplotype
133Mdo-HB-01-32_133Malus x domesticahaplotype
134Mdo-HB-01-32_134Malus x domesticahaplotype
135Mdo-HB-01-32_135Malus x domesticahaplotype
136Mdo-HB-01-32_136Malus x domesticahaplotype
137Mdo-HB-01-32_137Malus x domesticahaplotype
138Mdo-HB-01-32_138Malus x domesticahaplotype
139Mdo-HB-01-32_139Malus x domesticahaplotype
140Mdo-HB-01-32_140Malus x domesticahaplotype
141Mdo-HB-01-32_141Malus x domesticahaplotype
142Mdo-HB-01-32_142Malus x domesticahaplotype
143Mdo-HB-01-32_143Malus x domesticahaplotype
144Mdo-HB-01-32_144Malus x domesticahaplotype
145Mdo-HB-01-32_145Malus x domesticahaplotype
146Mdo-HB-01-32_146Malus x domesticahaplotype
147Mdo-HB-01-32_147Malus x domesticahaplotype
148Mdo-HB-01-32_148Malus x domesticahaplotype
149Mdo-HB-01-32_149Malus x domesticahaplotype
150Mdo-HB-01-32_150Malus x domesticahaplotype
151Mdo-HB-01-32_151Malus x domesticahaplotype
152Mdo-HB-01-32_152Malus x domesticahaplotype
153Mdo-HB-01-32_153Malus x domesticahaplotype
154Mdo-HB-01-32_154Malus x domesticahaplotype
155Mdo-HB-01-32_155Malus x domesticahaplotype
156Mdo-HB-01-32_156Malus x domesticahaplotype
157Mdo-HB-01-32_157Malus x domesticahaplotype
158Mdo-HB-01-32_158Malus x domesticahaplotype
159Mdo-HB-01-32_159Malus x domesticahaplotype
160Mdo-HB-01-32_160Malus x domesticahaplotype
161Mdo-HB-01-32_161Malus x domesticahaplotype
162Mdo-HB-01-32_162Malus x domesticahaplotype
163Mdo-HB-01-32_163Malus x domesticahaplotype
164Mdo-HB-01-32_164Malus x domesticahaplotype
165Mdo-HB-01-32_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1 ID=RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1|Name=RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1|organism=Malus x domestica|type=genetic_marker|length=70bp
CTCAGTGCGTGAGAATAGTTTCCGAATCTCATCTAMTCTGTTGGTAGGAG
GTACTTGGAAAGAAAATAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-20131N/A41.32RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1View
2Apple-M432-2013-physical-Malus-domestica1N/A26758625RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1View
3Apple-RosBREED-3.9K-20191N/A38.79RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1View
4Apple-Honeycrisp_Consensus-F11N/A38.79RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1View
5Pear-PH-CG-2017LG1N/A41.56RosBREEDSNP_SNP_AC_26758625_Lg1_01228_MAF10_223072_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC005900.194 contig MDC005900.194:5530..5530. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:26622102..26622102. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:26622101..26622101. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation