RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1, RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1
dbSNP IDss475879266
SNP Array ID
480K SNP array for apple:AX-105197356
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1
50K SNP array for apple:AX-105197356
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1.probe: CCTGGCACAAGACTCTCTGGTTTCTTTCACCTTCTTTTCCTCACTTCCAT
5' Flanking SequenceAGGGAATCCTTCCTGGCACAAGACTCTCTGGTTTCTTTCACCTTCTTTTCCTCACTTCCA T
3' Flanking SequenceGTTCTGCTCTAAACTTACTTCTTTGCAGCATGTAAATCCTTTACTATTTGCACCCTGGCA A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-PM-F1-Moonglow9N/A0RosBREED_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1View
2Apple-MM-F19N/A5.4a475879266View
3Pear-PH-CG-2017LG9N/A16.01RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1View
Sequence
>RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1 ID=RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1; Name=RosBREEDSNP_SNP_CT_1459011_Lg9_01339_MAF50_1643399_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
TCTGGTTTCTTTCACCTTCTTTTCCTCACTTCCAT[C/T]GTTCTGCTCT
AAACTTACTTCTTTGCAGCATGTAA
Alignments
Feature NameTypeLocationAnalysis
MDC014172.223 contig MDC014172.223:4706..4706. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr09 chromosome Chr09:1465854..1465854+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr09 chromosome Chr09:1505069..1505069. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation