CONS61, CONS61 (genetic_marker) Malus x domestica

Marker Overview
NameCONS61
dbSNP IDss475882320
SNP Array ID
480K SNP array for apple:AX-105201686
IRSC 9K SNP array for apple:CONS61
20K SNP array for apple:CONS61
50K SNP array for apple:AX-105201686
TypeSNP
SNP AllelesT/C
Probe 1CONS61.probe: ATCGGTGTGAATCAAGATAATCAGACTGACTTTGCAACGGCTGCAGTTTA
5' Flanking SequenceCGACATCGGTGTGAATCAAGATAATCAGACTGACTTTGCAACGGCTGCAGTTTA
3' Flanking SequenceGGAATGAAGTATTATAAAGATAATTTTGCTAGATTGGTGCTTGTGAAGACCATGATTGAT CCTGAAAACTTTTTCAAGAATAAGCAAAGTATCCCAACTCTTCCAAGGGTGGGAGATGGA TATATAAGAGGAATCTTACCTCTCATAGAGAGTGCTATCGGATAAGTT
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-Rg-F1-2014RG10N/A43.6CONS61View
2Apple-RosBREED-3.9K-201910N/A59.07CONS61View
3Apple-BB-F110N/A53.74CONS61View
4Apple-NC-F110N/A79.34CONS61View
5Apple-NCZFBB-consensus10N/A75.44CONS61View
6Apple-Honeycrisp_Consensus-F110N/A59.07CONS61View
Sequence
>CONS61 ID=CONS61; Name=CONS61; organism=Malus x domestica; type=genetic_marker; length=75bp
GATAATCAGACTGACTTTGCAACGGCTGCAGTTTA[C/T]GGAATGAAGT
ATTATAAAGATAATTTTGCTAGATT