RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1, RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1
Aliasss475881546
rs267614491
R_28678775_L15_96_2
dbSNP IDss475881546
SNP Array ID
20K SNP array for apple:AX-115181838
IRSC 9K SNP array for apple:AX-115181838
480K SNP array for apple:AX-115181838
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1.probe: GCATAGTAAGGAATATAAATGTTCTGATCAGTCAGCAGCCACTCCTTGTC
5' Flanking SequenceCTGAATTTCCATCTCTTGGAATATTTGAATGCATGGCAAAGCTTATTCACAAAGGACTCA A
3' Flanking SequenceGACAAGGAGTGGCTGCTGACTGATCAGAACATTTATATTCCTTACTATGCTGCTCATATC A
SpeciesMalus x domestica
PolymorphismP_ RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1
Publication[view all]
ContactMichela Troggio
Libraries
Library NameType
20K SNP array for appleSNP_chip
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1Malus x domesticamarker_locus
RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1-73.934Malus x domesticamarker_locus


The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1.probeMalus x domesticaprobe


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-15-46Mdo-HB-15-46Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-15-46_2Malus x domesticahaplotype
3Mdo-HB-15-46_3Malus x domesticahaplotype
4Mdo-HB-15-46_4Malus x domesticahaplotype
5Mdo-HB-15-46_5Malus x domesticahaplotype
6Mdo-HB-15-46_6Malus x domesticahaplotype
7Mdo-HB-15-46_7Malus x domesticahaplotype
8Mdo-HB-15-46_8Malus x domesticahaplotype
9Mdo-HB-15-46_9Malus x domesticahaplotype
10Mdo-HB-15-46_10Malus x domesticahaplotype
11Mdo-HB-15-46_11Malus x domesticahaplotype
12Mdo-HB-15-46_12Malus x domesticahaplotype
13Mdo-HB-15-46_13Malus x domesticahaplotype
14Mdo-HB-15-46_14Malus x domesticahaplotype
15Mdo-HB-15-46_15Malus x domesticahaplotype
16Mdo-HB-15-46_16Malus x domesticahaplotype
17Mdo-HB-15-46_17Malus x domesticahaplotype
18Mdo-HB-15-46_18Malus x domesticahaplotype
19Mdo-HB-15-46_19Malus x domesticahaplotype
20Mdo-HB-15-46_20Malus x domesticahaplotype
21Mdo-HB-15-46_21Malus x domesticahaplotype
22Mdo-HB-15-46_22Malus x domesticahaplotype
23Mdo-HB-15-46_23Malus x domesticahaplotype
24Mdo-HB-15-46_24Malus x domesticahaplotype
25Mdo-HB-15-46_25Malus x domesticahaplotype
26Mdo-HB-15-46_26Malus x domesticahaplotype
27Mdo-HB-15-46_27Malus x domesticahaplotype
28Mdo-HB-15-46_28Malus x domesticahaplotype
29Mdo-HB-15-46_29Malus x domesticahaplotype
30Mdo-HB-15-46_30Malus x domesticahaplotype
31Mdo-HB-15-46_31Malus x domesticahaplotype
32Mdo-HB-15-46_32Malus x domesticahaplotype
33Mdo-HB-15-46_33Malus x domesticahaplotype
34Mdo-HB-15-46_34Malus x domesticahaplotype
35Mdo-HB-15-46_35Malus x domesticahaplotype
36Mdo-HB-15-46_36Malus x domesticahaplotype
37Mdo-HB-15-46_37Malus x domesticahaplotype
38Mdo-HB-15-46_38Malus x domesticahaplotype
39Mdo-HB-15-46_39Malus x domesticahaplotype
40Mdo-HB-15-46_40Malus x domesticahaplotype
41Mdo-HB-15-46_41Malus x domesticahaplotype
42Mdo-HB-15-46_42Malus x domesticahaplotype
43Mdo-HB-15-46_43Malus x domesticahaplotype
44Mdo-HB-15-46_44Malus x domesticahaplotype
45Mdo-HB-15-46_45Malus x domesticahaplotype
46Mdo-HB-15-46_46Malus x domesticahaplotype
47Mdo-HB-15-46_47Malus x domesticahaplotype
48Mdo-HB-15-46_48Malus x domesticahaplotype
49Mdo-HB-15-46_49Malus x domesticahaplotype
50Mdo-HB-15-46_50Malus x domesticahaplotype
51Mdo-HB-15-46_51Malus x domesticahaplotype
52Mdo-HB-15-46_52Malus x domesticahaplotype
53Mdo-HB-15-46_53Malus x domesticahaplotype
54Mdo-HB-15-46_54Malus x domesticahaplotype
55Mdo-HB-15-46_55Malus x domesticahaplotype
56Mdo-HB-15-46_56Malus x domesticahaplotype
57Mdo-HB-15-46_57Malus x domesticahaplotype
58Mdo-HB-15-46_58Malus x domesticahaplotype
59Mdo-HB-15-46_59Malus x domesticahaplotype
60Mdo-HB-15-46_60Malus x domesticahaplotype
61Mdo-HB-15-46_61Malus x domesticahaplotype
62Mdo-HB-15-46_62Malus x domesticahaplotype
63Mdo-HB-15-46_63Malus x domesticahaplotype
64Mdo-HB-15-46_64Malus x domesticahaplotype
65Mdo-HB-15-46_65Malus x domesticahaplotype
66Mdo-HB-15-46_66Malus x domesticahaplotype
67Mdo-HB-15-46_67Malus x domesticahaplotype
68Mdo-HB-15-46_68Malus x domesticahaplotype
69Mdo-HB-15-46_69Malus x domesticahaplotype
70Mdo-HB-15-46_70Malus x domesticahaplotype
71Mdo-HB-15-46_71Malus x domesticahaplotype
72Mdo-HB-15-46_72Malus x domesticahaplotype
73Mdo-HB-15-46_73Malus x domesticahaplotype
74Mdo-HB-15-46_74Malus x domesticahaplotype
75Mdo-HB-15-46_75Malus x domesticahaplotype
76Mdo-HB-15-46_76Malus x domesticahaplotype
77Mdo-HB-15-46_77Malus x domesticahaplotype
78Mdo-HB-15-46_78Malus x domesticahaplotype
79Mdo-HB-15-46_79Malus x domesticahaplotype
80Mdo-HB-15-46_80Malus x domesticahaplotype
81Mdo-HB-15-46_81Malus x domesticahaplotype
82Mdo-HB-15-46_82Malus x domesticahaplotype
83Mdo-HB-15-46_83Malus x domesticahaplotype
84Mdo-HB-15-46_84Malus x domesticahaplotype
85Mdo-HB-15-46_85Malus x domesticahaplotype
86Mdo-HB-15-46_86Malus x domesticahaplotype
87Mdo-HB-15-46_87Malus x domesticahaplotype
88Mdo-HB-15-46_88Malus x domesticahaplotype
89Mdo-HB-15-46_89Malus x domesticahaplotype
90Mdo-HB-15-46_90Malus x domesticahaplotype
91Mdo-HB-15-46_91Malus x domesticahaplotype
92Mdo-HB-15-46_92Malus x domesticahaplotype
93Mdo-HB-15-46_93Malus x domesticahaplotype
94Mdo-HB-15-46_94Malus x domesticahaplotype
95Mdo-HB-15-46_95Malus x domesticahaplotype
96Mdo-HB-15-46_96Malus x domesticahaplotype
97Mdo-HB-15-46_97Malus x domesticahaplotype
98Mdo-HB-15-46_98Malus x domesticahaplotype
99Mdo-HB-15-46_99Malus x domesticahaplotype
100Mdo-HB-15-46_100Malus x domesticahaplotype
101Mdo-HB-15-46_101Malus x domesticahaplotype
102Mdo-HB-15-46_102Malus x domesticahaplotype
103Mdo-HB-15-46_103Malus x domesticahaplotype
104Mdo-HB-15-46_104Malus x domesticahaplotype
105Mdo-HB-15-46_105Malus x domesticahaplotype
106Mdo-HB-15-46_106Malus x domesticahaplotype
107Mdo-HB-15-46_107Malus x domesticahaplotype
108Mdo-HB-15-46_108Malus x domesticahaplotype
109Mdo-HB-15-46_109Malus x domesticahaplotype
110Mdo-HB-15-46_110Malus x domesticahaplotype
111Mdo-HB-15-46_111Malus x domesticahaplotype
112Mdo-HB-15-46_112Malus x domesticahaplotype
113Mdo-HB-15-46_113Malus x domesticahaplotype
114Mdo-HB-15-46_114Malus x domesticahaplotype
115Mdo-HB-15-46_115Malus x domesticahaplotype
116Mdo-HB-15-46_116Malus x domesticahaplotype
117Mdo-HB-15-46_117Malus x domesticahaplotype
118Mdo-HB-15-46_118Malus x domesticahaplotype
119Mdo-HB-15-46_119Malus x domesticahaplotype
120Mdo-HB-15-46_120Malus x domesticahaplotype
121Mdo-HB-15-46_121Malus x domesticahaplotype
122Mdo-HB-15-46_122Malus x domesticahaplotype
123Mdo-HB-15-46_123Malus x domesticahaplotype
124Mdo-HB-15-46_124Malus x domesticahaplotype
125Mdo-HB-15-46_125Malus x domesticahaplotype
126Mdo-HB-15-46_126Malus x domesticahaplotype
127Mdo-HB-15-46_127Malus x domesticahaplotype
128Mdo-HB-15-46_128Malus x domesticahaplotype
129Mdo-HB-15-46_129Malus x domesticahaplotype
130Mdo-HB-15-46_130Malus x domesticahaplotype
131Mdo-HB-15-46_131Malus x domesticahaplotype
132Mdo-HB-15-46_132Malus x domesticahaplotype
133Mdo-HB-15-46_133Malus x domesticahaplotype
134Mdo-HB-15-46_134Malus x domesticahaplotype
135Mdo-HB-15-46_135Malus x domesticahaplotype
136Mdo-HB-15-46_136Malus x domesticahaplotype
137Mdo-HB-15-46_137Malus x domesticahaplotype
138Mdo-HB-15-46_138Malus x domesticahaplotype
139Mdo-HB-15-46_139Malus x domesticahaplotype
140Mdo-HB-15-46_140Malus x domesticahaplotype
141Mdo-HB-15-46_141Malus x domesticahaplotype
142Mdo-HB-15-46_142Malus x domesticahaplotype
143Mdo-HB-15-46_143Malus x domesticahaplotype
144Mdo-HB-15-46_144Malus x domesticahaplotype
145Mdo-HB-15-46_145Malus x domesticahaplotype
146Mdo-HB-15-46_146Malus x domesticahaplotype
147Mdo-HB-15-46_147Malus x domesticahaplotype
148Mdo-HB-15-46_148Malus x domesticahaplotype
149Mdo-HB-15-46_149Malus x domesticahaplotype
150Mdo-HB-15-46_150Malus x domesticahaplotype
151Mdo-HB-15-46_151Malus x domesticahaplotype
152Mdo-HB-15-46_152Malus x domesticahaplotype
153Mdo-HB-15-46_153Malus x domesticahaplotype
154Mdo-HB-15-46_154Malus x domesticahaplotype
155Mdo-HB-15-46_155Malus x domesticahaplotype
156Mdo-HB-15-46_156Malus x domesticahaplotype
157Mdo-HB-15-46_157Malus x domesticahaplotype
158Mdo-HB-15-46_158Malus x domesticahaplotype
159Mdo-HB-15-46_159Malus x domesticahaplotype
160Mdo-HB-15-46_160Malus x domesticahaplotype
161Mdo-HB-15-46_161Malus x domesticahaplotype
162Mdo-HB-15-46_162Malus x domesticahaplotype
163Mdo-HB-15-46_163Malus x domesticahaplotype
164Mdo-HB-15-46_164Malus x domesticahaplotype
165Mdo-HB-15-46_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1 ID=RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1|Name=RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1|organism=Malus x domestica|type=genetic_marker|length=75bp
GAATGCATGGCAAAGCTTATTCACAAAGGACTCAA[C/T]GACAAGGAGT
GGCTGCTGACTGATCAGAACATTTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F115N/A79.18SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
2Apple_HC64_F115N/A32.44SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
3Apple_HCMO_F115N/A14.11SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
4Apple_HGMM_Consenus15N/A97.12SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
5Apple-M432-201311N/A4.3SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
6Apple-M432-2013-physical-Malus-domestica15N/A28678775SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
7Apple-RGTxGD-F1-2015RGT_15N/A61.21SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
8Apple-RosBREED-3.9K-201915N/A73.93SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
9Apple-Honeycrisp_Consensus-F115N/A73.93RosBREEDSNP_SNP_TC_28678775_Lg15_02592_MAF20_MDP0000161195_exon1View
Alignments
Feature NameTypeLocationAnalysis
MDC002329.267 contig MDC002329.267:2881..2881. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr15 chromosome Chr15:27052485..27052485- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr15 chromosome Chr15:27052486..27052485. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218