RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3, RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
Aliasss475882225
rs267615170
b475882225
SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
R_24825508_L17_PA
dbSNP IDss475882225
SNP Array ID
480K SNP array for apple:RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
20K SNP array for apple:RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
50K SNP array for apple:RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3
TypeSNP
SNP AllelesT/C
Probe 1RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3.probe: ACTTTTACGATCATCAAAATCTCCAGCATAGTCACTGTCTGTGAAGCCAA
5' Flanking SequenceATATGTAAAGGGGACAATTGATTATGATGTGTTCTACAAGAAGCAAGAAAATTCAGAATT T
3' Flanking SequenceTTGGCTTCACAGACAGTGACTATGCTGGAGATTTTGATGATCGTAAAAGTACTTATGGAC A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Relationships

The following probe feature(s) are associated with this genetic_marker:

Feature NameUnique NameSpeciesType
probeRosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3.probeMalus x domesticaprobe


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3 ID=RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3|Name=RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3|organism=Malus x domestica|type=genetic_marker|length=75bp
ATGTGTTCTACAAGAAGCAAGAAAATTCAGAATTT[A/G]TTGGCTTCAC
AGACAGTGACTATGCTGGAGATTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-M432-2013-physical-Malus-domestica17N/A24825508RosBREEDSNP_SNP_GA_24825508_Lg17_00341_MAF50_MDP0000296152_exon3View
Alignments
Feature NameTypeLocationAnalysis
MDC012852.408 contig MDC012852.408:7521..7521. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:32077713..32077713- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr17 chromosome Chr17:32077714..32077714. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation