RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1, RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1 (genetic_marker) Malus x domestica

Marker Overview
NameRosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1
dbSNP IDss475876629
SNP Array ID
480K SNP array for apple:AX-115182433
IRSC 9K SNP array for apple:RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1
20K SNP array for apple:RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1
50K SNP array for apple:AX-105190059
TypeSNP
SNP AllelesA/G
Probe 1RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1.probe: AGCCTTGGGCGTTTCAGTTGTCGTCATTTCAATTGTATCAATCAATAAGA
5' Flanking SequenceGAAATATTACTACAATGGATGATGATCGAAAGAAAATCGAAGAAATGAAAAACAAAAATG A
3' Flanking SequenceTCTTATTGATTGATACAATTGAAATGACGACAACTGAAACGCCCAAGGCTAAGGAGATTG A
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Associated WithGWAS0001213
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F117N/A41.11SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
2Apple_HC64_F117N/A34.78SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
3Apple_HCMO_F117N/A158.08SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
4Apple_HGMM_Consenus17N/A42.34SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
5Apple-RosBREED-3.9K-201917N/A32.86SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
6Apple-consensus-Allard-2016LG17N/A42.39SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
7Apple-Honeycrisp_Consensus-F117N/A32.86RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1View
Sequence
>RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1 ID=RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1; Name=RosBREEDSNP_SNP_CT_12943589_Lg17_151039_MAF10_151039_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp
CGAAAGAAAATCGAAGAAATGAAAAACAAAAATGA[C/T]TCTTATTGAT
TGATACAATTGAAATGACGACAACT
Alignments
Feature NameTypeLocationAnalysis
MDC009452.222 contig MDC009452.222:14044..14044. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr17 chromosome Chr17:12913506..12913506- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Annotated Terms
The following terms have been associated with this genetic_marker:
Vocabulary: Rosaceae Trait Ontology
TermDefinition
MAIN:000191457skin color