GDsnp00087, GDsnp00087 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00087
Aliasss475882282
rs267615227
b475882282
GD_SNP00087
ss475882282  
GD_SNP00087_F
dbSNP IDss475882282
SNP Array ID
480K SNP array for apple:GDsnp00087
IRSC 9K SNP array for apple:GDsnp00087
50K SNP array for apple:GDsnp00087
TypeSNP
SNP AllelesA/G
5' Flanking SequenceGCTTAAGTGCCAAAGTGAGAGCTCA
3' Flanking SequenceTCACACCTACATGTCCAACTCTTGA
SpeciesMalus x domestica
PolymorphismP_ GDsnp00087
Publication[view all]
ContactCindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Libraries
Library NameType
480K SNP array for appleSNP_chip
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
catechin contentqCAT.X5210X8402-LG1.J09Malus x domesticaQTL
epicatechin contentqECAT.X5210X8402-LG1.J10Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J09.procyanidinB1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.procyanidinB5Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.procyanidinC1Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.procyanidinDbMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.unknownProcyanidinMalus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.unknownFlavanol245Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG1.J10.quercitrinMalus x domesticaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
time of initial vegetative budbreakqTIVB.X3263xBr-ch1.1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00087GDsnp00087Malus x domesticamarker_locus
b475882282b475882282Malus x domesticamarker_locus
GD_SNP00087GD_SNP00087Malus x domesticamarker_locus
GDsnp00087GDsnp00087-27.81Malus x domesticamarker_locus


The following haplotype_block feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
Mdo-HB-01-25Mdo-HB-01-25Malus x domesticahaplotype_block


The following haplotype feature(s) contains this genetic_marker:

Feature NameUnique NameSpeciesType
2Mdo-HB-01-25_2Malus x domesticahaplotype
3Mdo-HB-01-25_3Malus x domesticahaplotype
4Mdo-HB-01-25_4Malus x domesticahaplotype
5Mdo-HB-01-25_5Malus x domesticahaplotype
6Mdo-HB-01-25_6Malus x domesticahaplotype
7Mdo-HB-01-25_7Malus x domesticahaplotype
8Mdo-HB-01-25_8Malus x domesticahaplotype
9Mdo-HB-01-25_9Malus x domesticahaplotype
10Mdo-HB-01-25_10Malus x domesticahaplotype
11Mdo-HB-01-25_11Malus x domesticahaplotype
12Mdo-HB-01-25_12Malus x domesticahaplotype
13Mdo-HB-01-25_13Malus x domesticahaplotype
14Mdo-HB-01-25_14Malus x domesticahaplotype
15Mdo-HB-01-25_15Malus x domesticahaplotype
16Mdo-HB-01-25_16Malus x domesticahaplotype
17Mdo-HB-01-25_17Malus x domesticahaplotype
18Mdo-HB-01-25_18Malus x domesticahaplotype
19Mdo-HB-01-25_19Malus x domesticahaplotype
20Mdo-HB-01-25_20Malus x domesticahaplotype
21Mdo-HB-01-25_21Malus x domesticahaplotype
22Mdo-HB-01-25_22Malus x domesticahaplotype
23Mdo-HB-01-25_23Malus x domesticahaplotype
24Mdo-HB-01-25_24Malus x domesticahaplotype
25Mdo-HB-01-25_25Malus x domesticahaplotype
26Mdo-HB-01-25_26Malus x domesticahaplotype
27Mdo-HB-01-25_27Malus x domesticahaplotype
28Mdo-HB-01-25_28Malus x domesticahaplotype
29Mdo-HB-01-25_29Malus x domesticahaplotype
30Mdo-HB-01-25_30Malus x domesticahaplotype
31Mdo-HB-01-25_31Malus x domesticahaplotype
32Mdo-HB-01-25_32Malus x domesticahaplotype
33Mdo-HB-01-25_33Malus x domesticahaplotype
34Mdo-HB-01-25_34Malus x domesticahaplotype
35Mdo-HB-01-25_35Malus x domesticahaplotype
36Mdo-HB-01-25_36Malus x domesticahaplotype
37Mdo-HB-01-25_37Malus x domesticahaplotype
38Mdo-HB-01-25_38Malus x domesticahaplotype
39Mdo-HB-01-25_39Malus x domesticahaplotype
40Mdo-HB-01-25_40Malus x domesticahaplotype
41Mdo-HB-01-25_41Malus x domesticahaplotype
42Mdo-HB-01-25_42Malus x domesticahaplotype
43Mdo-HB-01-25_43Malus x domesticahaplotype
44Mdo-HB-01-25_44Malus x domesticahaplotype
45Mdo-HB-01-25_45Malus x domesticahaplotype
46Mdo-HB-01-25_46Malus x domesticahaplotype
47Mdo-HB-01-25_47Malus x domesticahaplotype
48Mdo-HB-01-25_48Malus x domesticahaplotype
49Mdo-HB-01-25_49Malus x domesticahaplotype
50Mdo-HB-01-25_50Malus x domesticahaplotype
51Mdo-HB-01-25_51Malus x domesticahaplotype
52Mdo-HB-01-25_52Malus x domesticahaplotype
53Mdo-HB-01-25_53Malus x domesticahaplotype
54Mdo-HB-01-25_54Malus x domesticahaplotype
55Mdo-HB-01-25_55Malus x domesticahaplotype
56Mdo-HB-01-25_56Malus x domesticahaplotype
57Mdo-HB-01-25_57Malus x domesticahaplotype
58Mdo-HB-01-25_58Malus x domesticahaplotype
59Mdo-HB-01-25_59Malus x domesticahaplotype
60Mdo-HB-01-25_60Malus x domesticahaplotype
61Mdo-HB-01-25_61Malus x domesticahaplotype
62Mdo-HB-01-25_62Malus x domesticahaplotype
63Mdo-HB-01-25_63Malus x domesticahaplotype
64Mdo-HB-01-25_64Malus x domesticahaplotype
65Mdo-HB-01-25_65Malus x domesticahaplotype
66Mdo-HB-01-25_66Malus x domesticahaplotype
67Mdo-HB-01-25_67Malus x domesticahaplotype
68Mdo-HB-01-25_68Malus x domesticahaplotype
69Mdo-HB-01-25_69Malus x domesticahaplotype
70Mdo-HB-01-25_70Malus x domesticahaplotype
71Mdo-HB-01-25_71Malus x domesticahaplotype
72Mdo-HB-01-25_72Malus x domesticahaplotype
73Mdo-HB-01-25_73Malus x domesticahaplotype
74Mdo-HB-01-25_74Malus x domesticahaplotype
75Mdo-HB-01-25_75Malus x domesticahaplotype
76Mdo-HB-01-25_76Malus x domesticahaplotype
77Mdo-HB-01-25_77Malus x domesticahaplotype
78Mdo-HB-01-25_78Malus x domesticahaplotype
79Mdo-HB-01-25_79Malus x domesticahaplotype
80Mdo-HB-01-25_80Malus x domesticahaplotype
81Mdo-HB-01-25_81Malus x domesticahaplotype
82Mdo-HB-01-25_82Malus x domesticahaplotype
83Mdo-HB-01-25_83Malus x domesticahaplotype
84Mdo-HB-01-25_84Malus x domesticahaplotype
85Mdo-HB-01-25_85Malus x domesticahaplotype
86Mdo-HB-01-25_86Malus x domesticahaplotype
87Mdo-HB-01-25_87Malus x domesticahaplotype
88Mdo-HB-01-25_88Malus x domesticahaplotype
89Mdo-HB-01-25_89Malus x domesticahaplotype
90Mdo-HB-01-25_90Malus x domesticahaplotype
91Mdo-HB-01-25_91Malus x domesticahaplotype
92Mdo-HB-01-25_92Malus x domesticahaplotype
93Mdo-HB-01-25_93Malus x domesticahaplotype
94Mdo-HB-01-25_94Malus x domesticahaplotype
95Mdo-HB-01-25_95Malus x domesticahaplotype
96Mdo-HB-01-25_96Malus x domesticahaplotype
97Mdo-HB-01-25_97Malus x domesticahaplotype
98Mdo-HB-01-25_98Malus x domesticahaplotype
99Mdo-HB-01-25_99Malus x domesticahaplotype
100Mdo-HB-01-25_100Malus x domesticahaplotype
101Mdo-HB-01-25_101Malus x domesticahaplotype
102Mdo-HB-01-25_102Malus x domesticahaplotype
103Mdo-HB-01-25_103Malus x domesticahaplotype
104Mdo-HB-01-25_104Malus x domesticahaplotype
105Mdo-HB-01-25_105Malus x domesticahaplotype
106Mdo-HB-01-25_106Malus x domesticahaplotype
107Mdo-HB-01-25_107Malus x domesticahaplotype
108Mdo-HB-01-25_108Malus x domesticahaplotype
109Mdo-HB-01-25_109Malus x domesticahaplotype
110Mdo-HB-01-25_110Malus x domesticahaplotype
111Mdo-HB-01-25_111Malus x domesticahaplotype
112Mdo-HB-01-25_112Malus x domesticahaplotype
113Mdo-HB-01-25_113Malus x domesticahaplotype
114Mdo-HB-01-25_114Malus x domesticahaplotype
115Mdo-HB-01-25_115Malus x domesticahaplotype
116Mdo-HB-01-25_116Malus x domesticahaplotype
117Mdo-HB-01-25_117Malus x domesticahaplotype
118Mdo-HB-01-25_118Malus x domesticahaplotype
119Mdo-HB-01-25_119Malus x domesticahaplotype
120Mdo-HB-01-25_120Malus x domesticahaplotype
121Mdo-HB-01-25_121Malus x domesticahaplotype
122Mdo-HB-01-25_122Malus x domesticahaplotype
123Mdo-HB-01-25_123Malus x domesticahaplotype
124Mdo-HB-01-25_124Malus x domesticahaplotype
125Mdo-HB-01-25_125Malus x domesticahaplotype
126Mdo-HB-01-25_126Malus x domesticahaplotype
127Mdo-HB-01-25_127Malus x domesticahaplotype
128Mdo-HB-01-25_128Malus x domesticahaplotype
129Mdo-HB-01-25_129Malus x domesticahaplotype
130Mdo-HB-01-25_130Malus x domesticahaplotype
131Mdo-HB-01-25_131Malus x domesticahaplotype
132Mdo-HB-01-25_132Malus x domesticahaplotype
133Mdo-HB-01-25_133Malus x domesticahaplotype
134Mdo-HB-01-25_134Malus x domesticahaplotype
135Mdo-HB-01-25_135Malus x domesticahaplotype
136Mdo-HB-01-25_136Malus x domesticahaplotype
137Mdo-HB-01-25_137Malus x domesticahaplotype
138Mdo-HB-01-25_138Malus x domesticahaplotype
139Mdo-HB-01-25_139Malus x domesticahaplotype
140Mdo-HB-01-25_140Malus x domesticahaplotype
141Mdo-HB-01-25_141Malus x domesticahaplotype
142Mdo-HB-01-25_142Malus x domesticahaplotype
143Mdo-HB-01-25_143Malus x domesticahaplotype
144Mdo-HB-01-25_144Malus x domesticahaplotype
145Mdo-HB-01-25_145Malus x domesticahaplotype
146Mdo-HB-01-25_146Malus x domesticahaplotype
147Mdo-HB-01-25_147Malus x domesticahaplotype
148Mdo-HB-01-25_148Malus x domesticahaplotype
149Mdo-HB-01-25_149Malus x domesticahaplotype
150Mdo-HB-01-25_150Malus x domesticahaplotype
151Mdo-HB-01-25_151Malus x domesticahaplotype
152Mdo-HB-01-25_152Malus x domesticahaplotype
153Mdo-HB-01-25_153Malus x domesticahaplotype
154Mdo-HB-01-25_154Malus x domesticahaplotype
155Mdo-HB-01-25_155Malus x domesticahaplotype
156Mdo-HB-01-25_156Malus x domesticahaplotype
157Mdo-HB-01-25_157Malus x domesticahaplotype
158Mdo-HB-01-25_158Malus x domesticahaplotype
159Mdo-HB-01-25_159Malus x domesticahaplotype
160Mdo-HB-01-25_160Malus x domesticahaplotype
161Mdo-HB-01-25_161Malus x domesticahaplotype
162Mdo-HB-01-25_162Malus x domesticahaplotype
163Mdo-HB-01-25_163Malus x domesticahaplotype
164Mdo-HB-01-25_164Malus x domesticahaplotype
165Mdo-HB-01-25_165Malus x domesticahaplotype


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp00087 ID=GDsnp00087|Name=GDsnp00087|organism=Malus x domestica|type=genetic_marker|length=201bp
TGAATACTAAGACGACATGAAAACCTCATAAATGGTAGCAAAATCTGAGG
AGGCTAAAGTTACTTAGTACTTTATGCTTAAGTGCCAAAGTGAGAGCTCA
RTCACACCTACATGTCCAACTCTTGATATTAAACAGTAGGTAAACAGGTC
ACAAGGAAACTCGGCAATGTTTTGGTCAGATGGATTGGTCGAGAGTAAGA
G
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple_HCGA_F11N/A29.5GDsnp00087View
2Apple_HC64_F11N/A24.63GDsnp00087View
3Apple_HCMO_F11N/A29.22GDsnp00087View
4Apple_HGMM_Consenus1N/A33.41GDsnp00087View
5Apple Integrated map1N/A41.2GDsnp00087View
6Apple-JGxWSH-F1LG1N/A27GDsnp00087View
7Apple-WSH-F1LG1N/A30GDsnp00087View
8Apple-RosBREED-3.9K-20191N/A27.81GDsnp00087View
9Apple-MM-F11N/A33.7b475882282View
10Apple-X3263xBr-F11N/A38.7GD_SNP00087View
11Apple-X3259X3263-F11N/A45.3GD_SNP00087View
12Apple-X5210X8402-F1-ConsensusLG1N/A36.3GD_SNP00087View
13Apple-X5210X8402-F1-X8402LG1N/A43.6GD_SNP00087View
14Apple-GDxBr-F1-2013LG1N/A46.86GD_SNP00087View
15Apple-Honeycrisp_Consensus-F11N/A27.81GDsnp00087View
Alignments
Feature NameTypeLocationAnalysis
MDC005127.439 contig MDC005127.439:2052..2052. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr01 chromosome Chr01:24336467..24336467- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:24336417..24336517- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr01 chromosome Chr01:24336469..24336469. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation