GDsnp00346, GDsnp00346 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00346
Aliasss475882322
rs267615267
b475882322
AX-105200293
dbSNP IDss475882322
SNP Array ID
IRSC 9K SNP array for apple:GDsnp00346
50K SNP array for apple:GDsnp00346
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCTGCATAAACTCTCTCCTAAAGAACGCATTTCTGC
3' Flanking SequenceGATTCAAAAGCAGGTAAAAGGGACTTCTGCCTGT
SpeciesMalus x domestica
Publication[view all]
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp00346GDsnp00346Malus x domesticamarker_locus
GDsnp00346GDsnp00346-41.76Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp00346 ID=GDsnp00346|Name=GDsnp00346|organism=Malus x domestica|type=genetic_marker|length=70bp
CTGCATAAACTCTCTCCTAAAGAACGCATTTCTGCYGATTCAAAAGCAGG
TAAAAGGGACTTCTGCCTGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map10N/A65.7GDsnp00346View
2Pear-PM-F1-PEAR310N/A57.64GDsnp00346View
3Apple-M432-201310N/A78.59GDsnp00346View
4Apple-M432-2013-physical-Malus-domestica10N/A29921947GDsnp00346View
5Pear-PH-CG-2017LG10N/A41.76GDsnp00346View
Alignments
Feature NameTypeLocationAnalysis
MDC008274.344 contig MDC008274.344:12727..12727. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr05 chromosome Chr05:41742885..41742885. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr10 chromosome Chr10:35622589..35622589. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation