GDsnp00429, GDsnp00429 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp00429
dbSNP IDss475882522
SNP Array ID
480K SNP array for apple:AX-105195438
IRSC 9K SNP array for apple:GDsnp00429
20K SNP array for apple:GDsnp00429
50K SNP array for apple:AX-105195438
TypeSNP
SNP AllelesT/C
Probe 1GDsnp00429.probe: ACCACTTCAAGTGTAAACAATGATTGGTAATTAGTAAATAGGAAAACGCT
5' Flanking SequenceGCCCTCACATGACCCTGTTGAACTTGTTTTAGGGGATGGGAATTCCCGTAGGGAAGTTGG CTTTGTACACGGCACTTGGAGGAGTTCGCCCCTCAGCAGT
3' Flanking SequenceAGCGTTTTCCTATTTACTAATTACCAATCATTGTTTACACTTGAAGTGGTTGCATTGCAA ATCATTGATGTCATAGCGTTTTTATTCATTTTAACCAAGA
SpeciesMalus x domestica
Publication[view all]
ContactMichela Troggio
Contact
NameDetails
Michela Troggio
First name:Michela
Last name:Troggio
Title:Researcher
Institution:Research and Innovation Centre, Fondazione Edmund Mach
Address:Via Edmund Mach, 1, 38010 San Michele All'adige TN, Italy
Country:Italy
Email:ti.hcamf@oiggort.alehcim
Phone:+39 0461 615111
Fax:+39 0461 650218
Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2014Bianco L, Cestaro A, Sargent DJ, Banchi E, Derdak S, Di Guardo M, Salvi S, Jansen J, Viola R, Gut I, Laurens F, Chagné D, Velasco R, van de Weg E, Troggio M. Development and Validation of a 20K Single Nucleotide Polymorphism (SNP) Whole Genome Genotyping Array for Apple (Malus × domestica Borkh). PloS one. 2014; 9(10):e110377.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2011Micheletti D, Troggio M, Zharkikh A, Costa F, Malnoy M, Velasco R, Salvi S. Genetic diversity of the genus Malus and implications for linkage mapping with SNPs. Tree Genetics & Genomes. 2011; 7(4):857-868.
2016Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map15N/A46.3GDsnp00429View
2Apple-M432-201315N/A84.04GDsnp00429View
3Apple-M432-2013-physical-Malus-domestica15N/A14693846GDsnp00429View
4Apple-RosBREED-3.9K-201915N/A45.37GDsnp00429View
5Apple-NC-F115N/A56.94GDsnp00429View
6Apple-NCZFBB-consensus15N/A63.73GDsnp00429View
7Apple-ZF-F115N/A52.65GDsnp00429View
8Apple-consensus-Allard-2016LG15N/A55.34GDsnp00429View
9Apple-GB-F1LG_15N/A38.2GD_SNP00429View
10Apple-GDxBr-F1-2013LG15N/A38.23GD_SNP00429View
Sequence
>GDsnp00429 ID=GDsnp00429; Name=GDsnp00429; organism=Malus x domestica; type=genetic_marker; length=75bp
TACACGGCACTTGGAGGAGTTCGCCCCTCAGCAGT[A/G]AGCGTTTTCC
TATTTACTAATTACCAATCATTGTT
Alignments
Feature NameTypeLocationAnalysis
MDC022499.362 contig MDC022499.362:15232..15232. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr15 chromosome Chr15:15487356..15487356- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr15 chromosome Chr15:15487306..15487406- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation