DREB1, JQ669815.1-DREB1.m1 (mRNA) Malus x domestica

Unique NameJQ669815.1-DREB1.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB1DREB1Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ669815.1-DREB1.m1-cds1JQ669815.1-DREB1.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB1JQ669815.1-DREB1.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
JQ669815 region JQ669815:1..1008+ NCBI Rosaceae gene and mRNA sequences
Chr06 chromosome Chr06:17755036..17756249- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr6 chromosome chr6:12937149..12938363+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>JQ669815.1-DREB1.m1 ID=JQ669815.1-DREB1.m1|Name=DREB1|organism=Malus x domestica|type=mRNA|length=1008bp
back to top

protein sequence of DREB1

>JQ669815.1-DREB1.p1 ID=JQ669815.1-DREB1.p1|Name=DREB1|organism=Malus x domestica|type=polypeptide|length=335bp
back to top

mRNA from alignment at JQ669815:1..1008+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ669815.1-DREB1.m1 ID=JQ669815.1-DREB1.m1|Name=DREB1|organism=Malus x domestica|type=mRNA|length=1008bp|location=Sequence derived from alignment at JQ669815:1..1008+ (Malus x domestica)
atgtatatatacgagaagcggtttcctccaagcagcattactccaccttt gtgtgggaacttcggaacttgcctatgcgggcaacattttctccacctgg cgcctcctcacactccgtgtacaacttgcgtggtcctgggtcccactcaa agtcttagcaatccacaaaaaaaaccaacagctataagatccacctcact ctctctccaattttcaacttacaactccaaaaagaagtgtagtactgaaa cacactctcaactcacggctcaatttctccgacgcagcaccacaaaaatg aatacgatcttcagtactcaactctccgattcctccgaaaagcccgaatc gagttccgacgacacaagcatcacggctcaaagccagctggcttccttct ccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcgggg aggagagttttcaaggagacgaggcacccagtttacagaggagttaggag gaggaacaacaacaagtgggtgtgcgaaatgagggaaccaaacaagaaga agtcgaggatatggctcggaacttatccgacggccgagatggcagctcgg gcgcatgacgtggcggcattggcctttagagggaagcttgcctgcctcaa ttttgcagactccgcatggcgcctgcctgttccggcatccattgattcag cggatatcagacgggcggctgcggaggctgcagagacgttccggtcagcg gagtttggcggagtgttggaaagcggcgatgatgagaaggagagcaagaa aatggaggaggagaaggattgtggaggcgtggagggaagtggaatcttgt tttacttggatgaggaggaaatgttcgacatgccaaggttgctggatagt atggcggaagggcttctgctctctccgccgcactcttcaggtggctacat gaactgggatgacatgggaagcaatgatgacgtcagtctgtggagcttct caaattga
back to top

Coding sequence (CDS) from alignment at JQ669815:1..1008+

>JQ669815.1-DREB1.m1 ID=JQ669815.1-DREB1.m1|Name=DREB1|organism=Malus x domestica|type=CDS|length=1008bp|location=Sequence derived from alignment at JQ669815:1..1008+ (Malus x domestica)
back to top