S-RNase, EF653138.1-S-RNase.m1 (mRNA) Prunus humilis

Unique NameEF653138.1-S-RNase.m1
OrganismPrunus humilis ()

This mRNA is a part of the following gene feature(s):

Feature NameUnique NameSpeciesType
S-RNaseEF653138.1-S-RNasePrunus humilisgene

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
S-RNaseS-RNasePrunus humilisgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
EF653138.1-S-RNase.m1-cds1EF653138.1-S-RNase.m1-cds1Prunus humilisCDS
EF653138.1-S-RNase.m1-cds2EF653138.1-S-RNase.m1-cds2Prunus humilisCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
S-RNaseEF653138.1-S-RNase.p1Prunus humilispolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
EF653138 region EF653138:1..667+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>EF653138.1-S-RNase.m1 ID=EF653138.1-S-RNase.m1|Name=S-RNase|organism=Prunus humilis|type=mRNA|length=189bp
back to top

protein sequence of S-RNase

>EF653138.1-S-RNase.p1 ID=EF653138.1-S-RNase.p1|Name=S-RNase|organism=Prunus humilis|type=polypeptide|length=62bp
back to top

mRNA from alignment at EF653138:1..667+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>EF653138.1-S-RNase.m1 ID=EF653138.1-S-RNase.m1|Name=S-RNase|organism=Prunus humilis|type=mRNA|length=667bp|location=Sequence derived from alignment at EF653138:1..667+ (Prunus humilis)
tcacaattcatggcctatggccaagtaattattcaaatccaacgaagccc agcaattgcaatgggtcccgatttgaggcaaggaaactggtattgtttct gctcttttcttttttgactctttttttttgacttattctttagtatttag tttttagaaaatcatttagttttcaataaaccttcggtgttagataaaat tttgatgttagttccctggttaggcacattattttgaatatatatatata tatatatataagtatatttatattcgtggaagggggagggaatttctccc atacatttatatataaatacatttctatattttttattttttatggaagg atgaggagatttctcacatacattactaagttgtcatgatttgcaaataa atgccctttcactaggctacctaacattttgtacctatgaaattatcaaa attcaaaatcaatctacattcaggtttaatgaaaaaaataatcttatcca gaaattaaaatctaactgtcggtttaacttttttctcaaaatatgtaata ttgatcggatgtctcagtcccctaaactgcaaaacaaactgaagatatct tggccggacgtggaaagtggcaatgatacaagattttgggaaagcgaatg gaacaacacgcactgcc
back to top

Coding sequence (CDS) from alignment at EF653138:1..667+

>EF653138.1-S-RNase.m1 ID=EF653138.1-S-RNase.m1|Name=S-RNase|organism=Prunus humilis|type=CDS|length=189bp|location=Sequence derived from alignment at EF653138:1..667+ (Prunus humilis)
back to top