F3H, FJ919631.1-F3H.m1 (mRNA) Malus x domestica

Unique NameFJ919631.1-F3H.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
F3HF3HMalus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
FJ919631.1-F3H.m1-cds1FJ919631.1-F3H.m1-cds1Malus x domesticaCDS
FJ919631.1-F3H.m1-cds2FJ919631.1-F3H.m1-cds2Malus x domesticaCDS
FJ919631.1-F3H.m1-cds3FJ919631.1-F3H.m1-cds3Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
F3HFJ919631.1-F3H.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
FJ919631 region FJ919631:1371..4888+ NCBI Rosaceae gene and mRNA sequences
Chr14 chromosome Chr14:29630945..29634460+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr14 chromosome chr14:26508326..26511871- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr14 chromosome chr14:31153915..31157460+ Malus x domestica Whole Genome v1.0p Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>FJ919631.1-F3H.m1 ID=FJ919631.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=1536bp
back to top

protein sequence of F3H

>FJ919631.1-F3H.p1 ID=FJ919631.1-F3H.p1|Name=F3H|organism=Malus x domestica|type=polypeptide|length=511bp
back to top

mRNA from alignment at FJ919631:1371..4888+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>FJ919631.1-F3H.m1 ID=FJ919631.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=mRNA|length=3518bp|location=Sequence derived from alignment at FJ919631:1371..4888+ (Malus x domestica)
atgtttgttctcatagtcttcaccgtcgtctttgccttcttcttataccg gatatttgcccctggcgggagccgtcactctctgcctcttccgccggggc cgaaaccttggcctgtagtagggaacctgccccacttaggccccgttccc caccactctctggcggctttggcccgtcagtatggacccctcatgcacct ccgcttggggtttgttgacgtggttgttgccgcctccgcctccgtggcgt cacagtttctgaagacccatgacgctaatttctcgagccggccacccaac tccggcgccaagcatctcgcttacaactaccaagacttggtgttcgcgcc gtacggtccacggtggcgattgttgcggaagatcagctccgtccatttgt tctccggcaaggctctggatgatcttaaacacgttcgccaggtcagcaat ccggccaatccggccgtcgtcttcattgacttcgtccctttttacgttga ttttccctacgtttcattattaatgcatgttttattaattttcaatcaat cggaaactgaaaaataaaagaaaaacgaactaaatcttgtttaagtgcaa tcgaaaacgttgattttccctatgatcttaagtgctgttctcaaaagcgc ttttagtcatttaaaagcatttctcaaattttgtttgcaaagtaattttt tcatttgggatatttaattacaatttgtaattgttttaatattataggag gaggtaggtgtgcttgcacatggattagcaagtgcagggtcaaagccagt gaacttggcgcaactactgaacgtgtgcacggtgaacgccctagggcggg tgatggtaggacggaggctcttcggcaacggcatgggcggcgaagaccca aaggcggatgagttcaagtccatggtggtggagatgatggtgttggccgg agtattcaacatcggcgacttcatcccctccctagagtggctggacttgc agggggtggcgggaaagatgaagaagctacacaagaggttcgatgccttc ttgaccgccattgttgaagagcacaagaggagccgcggagggaagcacgt cgacatgctgacgacgttgctgtcgctcaaggaggatgccgacggtgagg gcgccaagctcacagacactgagattaaagctttgcttttggtacgtagc tcctctctctctctctctctctctctctctctctctctctctctaaggga agtaattatttgaaacgatttttaatcttccacatatattttttttattt ggcctaacaaattcaatttgatcaatttaattgtaaaaaaaatgtgcagg aagtgaaaaattgatgtgcaacaatcaacccgcttaaatttaaattacct ataaaaaaaatctctttattaaattaaaataaagtaaaaagataatttgc tcttttatcgcaaaagaaaaccacaggtggtatgtaatttcgatacaaat attttttttcacatgtcttcgtaacatatctctaattttttaaaataaaa atataaaatcctctccactctcacgttttctctcactccctctatctttc atattcctctccaacttctcttttccatgtattttctaaaaacaaaataa cttctttcacatgcaaagtgtgtgggggcttatgacttttgcaaacaata atacaatatgtcgtaactcaattattgaattggacatgacatgtcaacgt tgtaaaagaatgaggattctggatcgcctatgtgataatctcggagatct tcaaatcaaattcgtttattgtacatcatatggtcattttttatcaagta ctatttatatttaatcataaattaaaaattataataatttacgaccgcac gatatatgatgatttgatataattgaagaatttctaaaatcctcgtaaag agattctggaaataatcctcattcctctttaaaaaaccttggatggcctc gaggtttctctttgtcttaattaatttactttttcctcaaaagaaaagaa cgtaaagatttttnccttatttatttttcaatttttttgggagactggca agctagaaagttaatatgcactatttttactaatttccccaaaattcaaa aaaaaaaaaacatttttactttttcttcctgttttcatatatttggtagg ttagaaaagtaattttcttttccagttggccacgtgacctctctctcacg tgaaactttaaaatatgtcattagtggatcccccccgctccttgactgtc aaactactacaaaaagctatttaaataaggataaagggactttttcggat tcttttcgtcgggatttgaatgatcaattaatcgtgttaatttattgtat cgtatgataagttttattaggtaatatataaatatttaattttaaattta aaacataaaataatttttatcacacgatatacgataaacagacagaaata tatgttctggagatcatcagattttctcgtaacttccacaccgcatgttt ttaaatattttcatacacttggcatgaatttggtgatcgaaattaaattt tgtaagatgaaagggatctgtctttttataatttatggcacatattaacg tgcaccttctggttctttaaaattgattcaggtgtcttactaaatattga gagatttttcaacggtgtccaagtgtaaaaatataactagttggacattt aaaaaaatgtttaacctattgtattacaacatttgatgtaccgtgctgtg tctgacataattaaaaatttatctcaaataccaaatgactgacccataat atttttcatgcacacagaacatgtttacagctggcactgacacgtcatca agcacagtggaatgggccatagccgaactccttcgccaccccaaaattct agcccaactccaacaagagctggatcaagtcgtgggtcgggaccggctcg taaccgaatcggacctgcccaacctgacctacctccaagccgtgatcaag gaaaccttccggctccacccatccaccccgctctctcttccccgaatggc gaccgagagttgcgaaatcaacggatttcacattcctaagggtgccactc tcttggtcaacgtatgggccgtatctcgcgatccggatcaatggtccgaa ccgctcgagtttaggcccgagcggttcatgtcgggaggtgagaagcccaa tgtcgacattagggggaatgacttcgaggtcataccgttcggggccgggc gtagaatatgtgccgggatgagccttgggttgcggatggtgtctctgatg actgcaaccctggtccatggttttgattggaccttggccgatgggctgac ccctgagaagttgaacatggacgaggcctatgggctcaccctacaaagag ccgcaccgttaatggtgcacccgcgtaacaggctagcccctcatgcatac aatgcatcatcatcttga
back to top

Coding sequence (CDS) from alignment at FJ919631:1371..4888+

>FJ919631.1-F3H.m1 ID=FJ919631.1-F3H.m1|Name=F3H|organism=Malus x domestica|type=CDS|length=1536bp|location=Sequence derived from alignment at FJ919631:1371..4888+ (Malus x domestica)
back to top