MADS91, HM122612.1-MADS91.m1 (mRNA) Malus x domestica

Unique NameHM122612.1-MADS91.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
MADS91MADS91Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122612.1-MADS91.m1-cds1HM122612.1-MADS91.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
MADS91HM122612.1-MADS91.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HM122612 region HM122612:13..753+ NCBI Rosaceae gene and mRNA sequences
Chr09 chromosome Chr09:5120775..5125620+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr9 chromosome chr9:4405116..4409960+ Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr9 chromosome chr9:4406418..4411445- Malus x domestica Whole Genome v1.0 Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HM122612.1-MADS91.m1 ID=HM122612.1-MADS91.m1|Name=MADS91|organism=Malus x domestica|type=mRNA|length=741bp
back to top

protein sequence of MADS91

>HM122612.1-MADS91.p1 ID=HM122612.1-MADS91.p1|Name=MADS91|organism=Malus x domestica|type=polypeptide|length=246bp
back to top

mRNA from alignment at HM122612:13..753+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122612.1-MADS91.m1 ID=HM122612.1-MADS91.m1|Name=MADS91|organism=Malus x domestica|type=mRNA|length=741bp|location=Sequence derived from alignment at HM122612:13..753+ (Malus x domestica)
atggggagaggaagagtggagctgaagaggatagagaacaagataaacag gcaagtcacatttgcaaagagaagaaatgggcttctgaagaaagcttatg agctctccgttctctgtgatgctgaggttgctctcatcgtcttttccaac cgtggcaagctctatgagttttgtagcagccctagcattctccaaaccgt agacaggtaccaaaagtgtagttatggtgcggtggatcaagtcaacatac ctgcaaaggaacttgagagcagctatcgtgagtacatgaaactcaaaggt agatgtgagtccctacaacgaactcagagaaatcttcttggtgaggaatt gggtccattaaacacaaaggagcttgaacagcttgagcgccaacttgagg cctccttgaagcaagttaggtccactaagacccagtatatgctggaccaa ctttctgcccttcagaacaaggaacaactgttaatcgaagccaacaggga tttgacaatgaagttggatgaaattggttcaagaaatcaacttagacagt catgggaaggaggtgaccagggtatggcatatggaacccagcatcaccat gctcaatcccaagggttcttccagcctttagattgcaatcccactttgca aatagggtaccctgcagaggggtcagagcagatgggtgccacaactcatg cccaacaagtgaactgtttcatccctggatggatgctttga
back to top

Coding sequence (CDS) from alignment at HM122612:13..753+

>HM122612.1-MADS91.m1 ID=HM122612.1-MADS91.m1|Name=MADS91|organism=Malus x domestica|type=CDS|length=741bp|location=Sequence derived from alignment at HM122612:13..753+ (Malus x domestica)
back to top