BZIP15, HM122467.1-BZIP15.m1 (mRNA) Malus x domestica

Unique NameHM122467.1-BZIP15.m1
OrganismMalus x domestica (Apple)

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
BZIP15BZIP15Malus x domesticagene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
HM122467.1-BZIP15.m1-cds1HM122467.1-BZIP15.m1-cds1Malus x domesticaCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
BZIP15HM122467.1-BZIP15.p1Malus x domesticapolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
HM122467 region HM122467:362..1330+ NCBI Rosaceae gene and mRNA sequences
Chr07 chromosome Chr07:4856133..4859728- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr7 chromosome chr7:4115354..4119292- Malus x domestica Whole Genome v1.0 Assembly & Annotation
chr7 chromosome chr7:4481241..4485179- Malus x domestica Whole Genome v1.0p Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>HM122467.1-BZIP15.m1 ID=HM122467.1-BZIP15.m1|Name=BZIP15|organism=Malus x domestica|type=mRNA|length=969bp
back to top

protein sequence of BZIP15

>HM122467.1-BZIP15.p1 ID=HM122467.1-BZIP15.p1|Name=BZIP15|organism=Malus x domestica|type=polypeptide|length=322bp
back to top

mRNA from alignment at HM122467:362..1330+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>HM122467.1-BZIP15.m1 ID=HM122467.1-BZIP15.m1|Name=BZIP15|organism=Malus x domestica|type=mRNA|length=969bp|location=Sequence derived from alignment at HM122467:362..1330+ (Malus x domestica)
atggggatacagacaatgggatctcaaggtggggctgatggtaattgcaa acagccacagtttcagcctttgggacggcaaaactcaatgtacagtctca cattggatgaggtacagaatcagttaggtgacttggggaagccactcagc agcatgaaccttgatgagcttctaaaaaatgtatggagtgtggaagcaaa tcagaccatgggcatagatattgaaggcacgacactggtcaatcaagctc aactgcagcgtcaggcaagcctgtcattaactagtgcattgagcaagaag acagtcgatgaggtttggagagatattcaacaaagcaaagatgaagaaga aaagaaatctcaagaacgacaacggactttgggagagatgactttggagg atttcttggtcaaagccggagttgttgctgaagctgaagcatcttcggac aaacaatgtgctggtcctcttgttggggttgatgcgaatgtggcagcaca gtttccacaaggtcagtggatgcagtactcacaaccacaatatcagcatc cacaacaaagtatgatgggggtatacatgccaagccaacctataccaccg ccaatgcacgtaggggctggagctatgatggaagtcccgtatcctgacaa ccaagttccattgccttcacccttaatgggtgctctatcagatacgccga cacctgggaggaaaaggggcaaccctgaggacattgttgagaagactgtt gagcgaaggcaaaagagaatgataaagaaccgggaatctgctgcgcgttc gcgagcaaggaagcaggcatatacaaatgaactggagaacaaagtttcac gtctggaggaggaaaatgaaaggctaaggaaacagaaggagctagagaag gtgttgcccagtgcaccgcctccggagccaaagtaccagcttcggagaac atcatcagctccactctga
back to top

Coding sequence (CDS) from alignment at HM122467:362..1330+

>HM122467.1-BZIP15.m1 ID=HM122467.1-BZIP15.m1|Name=BZIP15|organism=Malus x domestica|type=CDS|length=969bp|location=Sequence derived from alignment at HM122467:362..1330+ (Malus x domestica)
back to top