SDH, AY037946.1-SDH.m1 (mRNA) Prunus cerasus

Unique NameAY037946.1-SDH.m1
OrganismPrunus cerasus ()

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
SDHSDHPrunus cerasusgene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
AY037946.1-SDH.m1-cds1AY037946.1-SDH.m1-cds1Prunus cerasusCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
SDHAY037946.1-SDH.p1Prunus cerasuspolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
AY037946 region AY037946:186..1292+ NCBI Rosaceae gene and mRNA sequences
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>AY037946.1-SDH.m1 ID=AY037946.1-SDH.m1|Name=SDH|organism=Prunus cerasus|type=mRNA|length=1107bp
back to top

protein sequence of SDH

>AY037946.1-SDH.p1 ID=AY037946.1-SDH.p1|Name=SDH|organism=Prunus cerasus|type=polypeptide|length=368bp
back to top

mRNA from alignment at AY037946:186..1292+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>AY037946.1-SDH.m1 ID=AY037946.1-SDH.m1|Name=SDH|organism=Prunus cerasus|type=mRNA|length=1107bp|location=Sequence derived from alignment at AY037946:186..1292+ (Prunus cerasus)
atgggtaagggagggatgtcttctcagggaggggctctagaacccatgga tggtgaacaagaaaacatggctgcttggcttgtgggtgtgaacaccctca agattcaacctttcaagctccccactgttggtcccaatgatgtcagagtc aagataaaggctgttgggatatgcggaagtgatgtccactacctcaagac catgaaatgtgcagactttattgttcaagagcccatggtaattgggcatg aatgtgccggaattgttgacgaagttggtagcatggtgaagaatctgctg cccggagatcgcgtggctctagagcccggcatcagctgctggagatgcga gcagtgcaagggcgggcgatacaatctctgcccagacatgaagttcttcg ccaccccaccagtccacggctcattggcaaatcagattgtgcaccctgca gatctgtgcttcaagctcccggagaatgtgagtttggaggaaggggccat gtgcgagcccctgagtgttggtgttcatgcctgtcggcgagccaatatcg gcccagaaacaaatgtcctggtgatcggagcagggccaatcgggcttgtg tcggtgctctctgctcgtgcttttggggcagccagaattgtcattgtgga tgtggatgatgagcgcttatccattgctaagtctctaggcgccgatgact ccgtcaaagtctcaacaaacccacaggatttagaaaatgaagtttctaag ataagtaaggccatgagaggtggagtagatgtgagctttgactgtgtggg ttttaataaaactatgtcaacggccctcagcgccacccgtccgggcggca aagtttgcctcgtgggcatgggtcacggcgtgatgactgtccccctcacc cccgccgctgccagggaagttgatgtggttggaatattccggtataagaa cacatggccgctgtgcctggagtttttgagaaccggtaagatcgatgtga agcccctgataactcaccgtttcggattcacccagaaggagattgaagaa gccttcgaaacgagcgcgcgtggaggaaatgccattaaagtcatgtttaa tttgtaa
back to top

Coding sequence (CDS) from alignment at AY037946:186..1292+

>AY037946.1-SDH.m1 ID=AY037946.1-SDH.m1|Name=SDH|organism=Prunus cerasus|type=CDS|length=1107bp|location=Sequence derived from alignment at AY037946:186..1292+ (Prunus cerasus)
back to top