Ripening time, qRP.SP-G3 (QTL) Prunus persica

QTL Overview
QTL LabelqRPT.SP-G3
Published SymbolRp
Trait Nameripening time
Trait Aliasharvesting. maturity date. harvesting date.
Trait StudyPeach quality traits-Quilot-2004
PopulationSummergrand_x_P1908-BC2
Female ParentZephir
Male ParentSD40_x_Summergrand
Colocalizing MarkerN/A
Neighboring MarkerCC2
EnvironmentN/A
LODN/A
Additivity Dominance RatioN/A
R2N/A
CommentsN/A
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Peach-SP-BC2-2004G3N/AN/A---View
Alignments
Feature NameTypeLocationAnalysis
Pp03 chromosome Pp03:17574542..17574964. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
scaffold_3 supercontig scaffold_3:12231238..12231660. Prunus persica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Pp03:17574542..17574964

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qRPT.SP-G3 ID=qRPT.SP-G3; Name=ripening time; organism=Prunus persica; type=QTL; length=423bp; location=Sequence derived from: Pp03:17574542..17574964 (Prunus persica
ACTATGATGGAAGGTACTGGACCATGTGGAAGCTGCCCATGTTTGGATGC ACAGACTCTTCCCAAGTGTTGAAAGAGCTCGAGGAGGCCAAGAAGGCTAA CCCCAACTCTTTCATCCGTATCATCGGATTCGACAACGTTCGTCAAGTGC AGTGCATCAGTTTCATCGCCTACAAGCCTGCAGGCTACTAATTTCAAGTT TCATGATTTTTATTTTATGTTGTTTGTGGCTTGTTAGCCAAGGGTCTCGG TGGTTTGTTTAAGTCTGTACTTAATTAGGCCTTTCAAGACCTTTGTTGGT TTCTTTTCTTTCCCTTTTTCGAGACAATTTCCTTTGTTTTCGAAGTTGGT GTTTTTCGGATTCATAATGTGGTGGTGTTGAGAATATTCATGAATAAAAT GATATCCGTATTTTATTTTCAGT
back to top

QTL from alignment at scaffold_3:12231238..12231660

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qRPT.SP-G3 ID=qRPT.SP-G3; Name=ripening time; organism=Prunus persica; type=QTL; length=423bp; location=Sequence derived from: scaffold_3:12231238..12231660 (Prunus persica
ACTATGATGGAAGGTACTGGACCATGTGGAAGCTGCCCATGTTTGGATGC ACAGACTCTTCCCAAGTGTTGAAAGAGCTCGAGGAGGCCAAGAAGGCTAA CCCCAACTCTTTCATCCGTATCATCGGATTCGACAACGTTCGTCAAGTGC AGTGCATCAGTTTCATCGCCTACAAGCCTGCAGGCTACTAATTTCAAGTT TCATGATTTTTATTTTATGTTGTTTGTGGCTTGTTAGCCAAGGGTCTCGG TGGTTTGTTTAAGTCTGTACTTAATTAGGCCTTTCAAGACCTTTGTTGGT TTCTTTTCTTTCCCTTTTTCGAGACAATTTCCTTTGTTTTCGAAGTTGGT GTTTTTCGGATTCATAATGTGGTGGTGTTGAGAATATTCATGAATAAAAT GATATCCGTATTTTATTTTCAGT
back to top