dry matter content, q.DMC.RB-RG1.Motueka-2009 (QTL) Malus x domestica

QTL Overview
QTL Labelq.DMC.RB-RG1.Motueka-2009
Published SymbolN/A
Trait Namedry matter content
Trait AliasN/A
Trait StudyApple-Envirnonmental_Interaction_Phenotypes-Tustin-2014
PopulationRoyal_Gala
Female ParentN/A
Male ParentN/A
Colocalizing MarkerGDsnp01678
Neighboring MarkerN/A
EnvironmentN/A
LOD4.12
Additivity Dominance RatioN/A
R26.4
CommentsN/A
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr01chromosomeChr01:30652680..30652780 .Malus x domestica GDDH13 v1.1 Whole Genome Assembly & AnnotationGDR QTL alignment to genome using associated markers
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-Rg-F1-2014RG1N/AN/A51--View
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr01:30652680..30652780

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>q.DMC.RB-RG1.Motueka-2009 ID=q.DMC.RB-RG1.Motueka-2009; Name=dry matter content; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr01:30652680..30652780 (Malus x domestica
TGCCATGCAGTAAGAGCATACAACGGAGATTGGCTTTGTATCAAGGCGTA CGTCCCATACACCTCTTTTATGGGTGATGCTGTCCACACACTTCTTTTAA T
back to top