harvest date, qHD.RB-B2.Hawke's_Bay-2009 (QTL) Malus x domestica

QTL Overview
QTL LabelqHD.RB-B2.Hawke's_Bay-2009
Published SymbolN/A
Trait Nameharvest date
Trait AliasN/A
Trait StudyApple-Envirnonmental_Interaction_Phenotypes-Tustin-2014
PopulationBraeburn
Female ParentDelicious
Male ParentUP_Braeburn
Colocalizing MarkerGDsnp00308
Neighboring MarkerN/A
EnvironmentN/A
LOD6.06
Additivity Dominance RatioN/A
R26
CommentsN/A
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-B-F1-2014B2N/AN/A13--View
Alignments
Feature NameTypeLocationAnalysis
Chr02 chromosome Chr02:6470063..6470163. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
MDC011970.92 contig MDC011970.92:15201..15201. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr02:6470063..6470163

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-B2.Hawke's_Bay-2009 ID=qHD.RB-B2.Hawke's_Bay-2009; Name=harvest date; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr02:6470063..6470163 (Malus x domestica
TATCATAGTTGAATTATACGAGACACGTACTTATGGGGCAGCAGACCCAA CAATTAGAGATGAGACATGTAGGAAACACATACTTAAGGGACAGTAGACC C
back to top

QTL from alignment at MDC011970.92:15201..15201

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-B2.Hawke's_Bay-2009 ID=qHD.RB-B2.Hawke's_Bay-2009; Name=harvest date; organism=Malus x domestica; type=QTL; length=1bp; location=Sequence derived from: MDC011970.92:15201..15201 (Malus x domestica
Y
back to top