harvest date, qHD.RB-RG5.Motueka-2010 (QTL) Malus x domestica

QTL Overview
QTL LabelqHD.RB-RG5.Motueka-2010
Published SymbolN/A
Trait Nameharvest date
Trait AliasN/A
Trait StudyApple-Envirnonmental_Interaction_Phenotypes-Tustin-2014
PopulationRoyal_Gala
Female ParentN/A
Male ParentN/A
Colocalizing MarkerGDsnp01942
Neighboring MarkerN/A
EnvironmentN/A
LOD4.24
Additivity Dominance RatioN/A
R23.7
CommentsN/A
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-Rg-F1-2014RG5N/AN/A16--View
Alignments
Feature NameTypeLocationAnalysis
Chr05 chromosome Chr05:41343521..41343621. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
MDC015054.310 contig MDC015054.310:427..427. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr05:41343521..41343621

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-RG5.Motueka-2010 ID=qHD.RB-RG5.Motueka-2010; Name=harvest date; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr05:41343521..41343621 (Malus x domestica
TTTTAGTGAAACGATAGAGTTAATAAGTTAAATGTTAGATTATCCACCGA TGAGATTCGAACCCACACCATCATGCAAGGTCACAACACATTTCCACCAC T
back to top

QTL from alignment at MDC015054.310:427..427

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-RG5.Motueka-2010 ID=qHD.RB-RG5.Motueka-2010; Name=harvest date; organism=Malus x domestica; type=QTL; length=1bp; location=Sequence derived from: MDC015054.310:427..427 (Malus x domestica
C
back to top